Incidental Mutation 'R5943:Pcca'
ID460444
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
MMRRC Submission 044135-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5943 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122658776 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 268 (I268N)
Ref Sequence ENSEMBL: ENSMUSP00000038763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374]
Predicted Effect probably damaging
Transcript: ENSMUST00000038374
AA Change: I268N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650
AA Change: I268N

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143240
Predicted Effect unknown
Transcript: ENSMUST00000177312
AA Change: I149N
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C A 17: 45,517,711 Q671K probably benign Het
Acaa2 A G 18: 74,792,382 H72R probably damaging Het
Acad8 A G 9: 26,999,444 L18P probably benign Het
Acap3 T C 4: 155,899,422 V115A possibly damaging Het
Adamts9 T C 6: 92,903,786 T503A probably benign Het
Adcy1 T C 11: 7,161,337 F876S probably damaging Het
Adgrv1 T C 13: 81,386,866 E5760G probably damaging Het
Ankrd26 A T 6: 118,505,746 I1631K probably damaging Het
Ccdc150 A G 1: 54,300,367 T457A probably benign Het
Cd163 T C 6: 124,329,602 *1160R probably null Het
Cdc6 T C 11: 98,920,763 S517P probably damaging Het
Cenpf A T 1: 189,659,969 D555E possibly damaging Het
Clcn1 T A 6: 42,292,966 I241N probably damaging Het
Clrn2 A T 5: 45,463,719 I152F probably benign Het
Col4a4 A G 1: 82,525,016 I349T unknown Het
Coq8b T A 7: 27,234,003 F96L probably damaging Het
Cp A T 3: 19,964,306 N58I probably benign Het
Dcst1 A T 3: 89,356,411 probably null Het
Dhrs3 A T 4: 144,919,976 M199L possibly damaging Het
Dido1 A T 2: 180,661,882 S1410T probably benign Het
Dnase1l2 C T 17: 24,442,747 A13T probably damaging Het
Duox1 G A 2: 122,333,435 R861Q probably benign Het
Eya2 A G 2: 165,724,689 H220R probably damaging Het
Fas T G 19: 34,320,587 probably null Het
Fezf1 T A 6: 23,246,949 K295* probably null Het
Gldn T G 9: 54,338,437 I424R possibly damaging Het
Gm9047 T A 6: 29,471,909 L128Q possibly damaging Het
Gnptab T C 10: 88,433,514 V693A probably benign Het
Gsdma A T 11: 98,673,026 T269S probably benign Het
Hectd4 A T 5: 121,322,294 T2209S probably benign Het
Hoxd3 A G 2: 74,746,829 N351S probably benign Het
Itpkc T A 7: 27,212,979 N581I possibly damaging Het
Kank3 G T 17: 33,818,401 E226D probably damaging Het
Krtap5-1 A G 7: 142,297,051 S7P unknown Het
Lrriq3 A G 3: 155,163,950 Y304C probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mdn1 T C 4: 32,678,330 S653P probably damaging Het
Mri1 A T 8: 84,254,319 L194* probably null Het
Mtus1 T C 8: 41,084,265 E138G probably benign Het
Myo3b G A 2: 70,286,941 R906Q probably benign Het
Nckipsd C T 9: 108,812,236 P199S possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr669 T A 7: 104,938,643 I39N possibly damaging Het
Pacsin1 T C 17: 27,706,071 L253P probably damaging Het
Pcdhga8 A G 18: 37,816,512 D327G probably damaging Het
Pcnx4 A G 12: 72,579,458 H1146R probably damaging Het
Pnmal2 T C 7: 16,946,437 S449P probably benign Het
Psmb9 T C 17: 34,184,291 E61G probably damaging Het
Pxylp1 A G 9: 96,839,150 Y101H probably damaging Het
Radil A G 5: 142,485,458 I1044T probably damaging Het
Rnf43 G A 11: 87,731,735 R554H probably damaging Het
Sp5 A T 2: 70,475,315 Q17L probably null Het
Strn C A 17: 78,669,847 V211F probably damaging Het
Sult3a1 A G 10: 33,866,641 D88G probably damaging Het
Trim14 T C 4: 46,522,136 I180M probably benign Het
Tsnax C A 8: 125,024,539 S90* probably null Het
Ttn A G 2: 76,968,436 M498T probably benign Het
Vmn1r198 T A 13: 22,355,197 Y195* probably null Het
Vmn2r70 T C 7: 85,565,991 T112A probably benign Het
Wdr66 A G 5: 123,286,357 T205A probably benign Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Yme1l1 G T 2: 23,168,330 R158L probably damaging Het
Zc2hc1c C A 12: 85,289,709 H47N probably damaging Het
Zc3h10 C A 10: 128,545,527 probably benign Het
Zfp825 T C 13: 74,480,888 R170G probably benign Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
PIT4812001:Pcca UTSW 14 122790382 missense probably benign 0.00
R0549:Pcca UTSW 14 122638377 splice site probably benign
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R1749:Pcca UTSW 14 122701130 missense probably damaging 0.97
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2020:Pcca UTSW 14 122813222 missense possibly damaging 0.64
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6317:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6361:Pcca UTSW 14 122638382 missense probably benign 0.07
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
R7243:Pcca UTSW 14 122876774 missense probably benign
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGTAGTGAGTCTAATCTGTTCCCCG -3'
(R):5'- AGTCATGGAAGACACTGCTG -3'

Sequencing Primer
(F):5'- CCCGTTTTTCTTAATTAAGCTGAAAC -3'
(R):5'- GCTGGAATTTGAACTCAGGACCTC -3'
Posted On2017-02-28