Incidental Mutation 'R5920:Fam105a'
ID461537
Institutional Source Beutler Lab
Gene Symbol Fam105a
Ensembl Gene ENSMUSG00000056069
Gene Namefamily with sequence similarity 105, member A
Synonyms
MMRRC Submission 044117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5920 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location27655069-27681579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27664356 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 109 (R109S)
Ref Sequence ENSEMBL: ENSMUSP00000153902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100739] [ENSMUST00000226145] [ENSMUST00000226170] [ENSMUST00000226581]
Predicted Effect probably benign
Transcript: ENSMUST00000100739
AA Change: R109S

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098305
Gene: ENSMUSG00000056069
AA Change: R109S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Peptidase_C101 85 114 4e-10 PFAM
Pfam:Peptidase_C101 112 302 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226145
AA Change: R109S

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226170
AA Change: R109S

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000226581
Predicted Effect probably benign
Transcript: ENSMUST00000231473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232492
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Fam105a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Fam105a APN 15 27658116 missense possibly damaging 0.93
IGL01662:Fam105a APN 15 27658065 missense probably damaging 1.00
IGL02991:Fam105a UTSW 15 27658302 missense possibly damaging 0.88
R0349:Fam105a UTSW 15 27664790 missense probably benign 0.01
R0726:Fam105a UTSW 15 27656947 missense probably damaging 1.00
R1054:Fam105a UTSW 15 27664549 missense probably damaging 1.00
R1201:Fam105a UTSW 15 27658173 nonsense probably null
R3001:Fam105a UTSW 15 27664706 missense probably benign 0.00
R3002:Fam105a UTSW 15 27664706 missense probably benign 0.00
R4362:Fam105a UTSW 15 27664343 critical splice donor site probably null
R4363:Fam105a UTSW 15 27664343 critical splice donor site probably null
R5340:Fam105a UTSW 15 27658089 missense possibly damaging 0.75
R5364:Fam105a UTSW 15 27659945 nonsense probably null
R7044:Fam105a UTSW 15 27657235 intron probably benign
R7175:Fam105a UTSW 15 27658288 missense probably damaging 1.00
R7229:Fam105a UTSW 15 27658187 missense probably benign 0.35
R7305:Fam105a UTSW 15 27658233 missense probably benign 0.07
R8346:Fam105a UTSW 15 27664558 missense probably damaging 1.00
X0025:Fam105a UTSW 15 27659942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTGTCCTGTCATGCTC -3'
(R):5'- GGTGGATCGGCTATCTACAGAG -3'

Sequencing Primer
(F):5'- TCACTTGAGGGACTGACCACATTAG -3'
(R):5'- GATCGGCTATCTACAGAGAAAGTTC -3'
Posted On2017-02-28