Incidental Mutation 'R1201:Fam105a'
ID101417
Institutional Source Beutler Lab
Gene Symbol Fam105a
Ensembl Gene ENSMUSG00000056069
Gene Namefamily with sequence similarity 105, member A
Synonyms
MMRRC Submission 039271-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1201 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location27655069-27681579 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 27658173 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 84 (Q84*)
Ref Sequence ENSEMBL: ENSMUSP00000154311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100739] [ENSMUST00000226145] [ENSMUST00000226170] [ENSMUST00000226581]
Predicted Effect probably null
Transcript: ENSMUST00000100739
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000098305
Gene: ENSMUSG00000056069
AA Change: Q204*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Peptidase_C101 85 114 4e-10 PFAM
Pfam:Peptidase_C101 112 302 1.1e-79 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226145
AA Change: Q254*
Predicted Effect probably null
Transcript: ENSMUST00000226170
AA Change: Q254*
Predicted Effect probably null
Transcript: ENSMUST00000226581
AA Change: Q84*
Predicted Effect probably benign
Transcript: ENSMUST00000231473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232492
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,716,282 T103A possibly damaging Het
4932438A13Rik A G 3: 36,948,375 S1490G probably benign Het
Acly A G 11: 100,493,935 I674T probably damaging Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Actc1 A G 2: 114,049,513 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arhgap40 A C 2: 158,534,769 D275A probably damaging Het
Car11 A G 7: 45,703,480 D221G probably benign Het
Catsperg1 A T 7: 29,191,670 H596Q possibly damaging Het
Ccm2 T C 11: 6,593,682 V231A probably benign Het
Crh A G 3: 19,693,926 I184T probably damaging Het
Csgalnact2 A G 6: 118,114,432 S424P probably damaging Het
Dbf4 A C 5: 8,397,498 L571V possibly damaging Het
Fancm A G 12: 65,106,768 K66E possibly damaging Het
Hydin T C 8: 110,569,855 V3672A probably benign Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Krt36 T C 11: 100,104,057 N230D probably benign Het
Nlrp4b G T 7: 10,715,436 R522L possibly damaging Het
Ntn1 T C 11: 68,213,226 D532G probably damaging Het
Numb A T 12: 83,801,285 V215D probably damaging Het
Olfr1355 A T 10: 78,879,477 M102L probably benign Het
Olfr1415 T G 1: 92,491,153 I201L probably benign Het
Olfr175-ps1 A G 16: 58,823,863 I282T probably damaging Het
Olfr54 T A 11: 51,027,110 M36K probably damaging Het
Olfr727 T A 14: 50,127,356 W260R probably damaging Het
Pidd1 A G 7: 141,440,274 F580L probably benign Het
Plekhg4 A G 8: 105,381,673 D1116G probably damaging Het
Prss33 G T 17: 23,835,110 S74* probably null Het
Rab34 T A 11: 78,190,396 probably null Het
Rims2 A C 15: 39,616,324 T1251P possibly damaging Het
Skint5 A G 4: 113,556,145 S1152P unknown Het
Slc6a17 T A 3: 107,493,072 Q206L possibly damaging Het
Tmem59l C T 8: 70,484,387 W310* probably null Het
Tnrc6c T G 11: 117,721,674 N379K probably damaging Het
Vmn1r76 A C 7: 11,930,325 F286V probably benign Het
Xdh T C 17: 73,918,418 D463G probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp263 T A 16: 3,749,430 H536Q probably damaging Het
Zfp607a T A 7: 27,879,311 F602Y probably damaging Het
Other mutations in Fam105a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Fam105a APN 15 27658116 missense possibly damaging 0.93
IGL01662:Fam105a APN 15 27658065 missense probably damaging 1.00
IGL02991:Fam105a UTSW 15 27658302 missense possibly damaging 0.88
R0349:Fam105a UTSW 15 27664790 missense probably benign 0.01
R0726:Fam105a UTSW 15 27656947 missense probably damaging 1.00
R1054:Fam105a UTSW 15 27664549 missense probably damaging 1.00
R3001:Fam105a UTSW 15 27664706 missense probably benign 0.00
R3002:Fam105a UTSW 15 27664706 missense probably benign 0.00
R4362:Fam105a UTSW 15 27664343 critical splice donor site probably null
R4363:Fam105a UTSW 15 27664343 critical splice donor site probably null
R5340:Fam105a UTSW 15 27658089 missense possibly damaging 0.75
R5364:Fam105a UTSW 15 27659945 nonsense probably null
R5920:Fam105a UTSW 15 27664356 missense possibly damaging 0.58
R7044:Fam105a UTSW 15 27657235 intron probably benign
R7175:Fam105a UTSW 15 27658288 missense probably damaging 1.00
R7229:Fam105a UTSW 15 27658187 missense probably benign 0.35
R7305:Fam105a UTSW 15 27658233 missense probably benign 0.07
R8346:Fam105a UTSW 15 27664558 missense probably damaging 1.00
X0025:Fam105a UTSW 15 27659942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAGTCCTACTCACCTGATCC -3'
(R):5'- TACCAGTTCACACGTCCCAGTTCAC -3'

Sequencing Primer
(F):5'- TGATCCAAACCACAAGTGTCG -3'
(R):5'- GTCCCAGTTCACACTTACCAG -3'
Posted On2014-01-15