Incidental Mutation 'R0502:Rab35'
ID 47194
Institutional Source Beutler Lab
Gene Symbol Rab35
Ensembl Gene ENSMUSG00000029518
Gene Name RAB35, member RAS oncogene family
Synonyms RAB1C, 9530019H02Rik, H-ray
MMRRC Submission 038697-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0502 (G1)
Quality Score 130
Status Validated
Chromosome 5
Chromosomal Location 115631908-115647736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 115645664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 170 (R170Q)
Ref Sequence ENSEMBL: ENSMUSP00000031492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031492] [ENSMUST00000055408] [ENSMUST00000118576] [ENSMUST00000121746] [ENSMUST00000138885] [ENSMUST00000141976]
AlphaFold Q6PHN9
Predicted Effect probably benign
Transcript: ENSMUST00000031492
AA Change: R170Q

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031492
Gene: ENSMUSG00000029518
AA Change: R170Q

DomainStartEndE-ValueType
RAB 9 171 5.07e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055408
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118576
SMART Domains Protein: ENSMUSP00000112842
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121746
SMART Domains Protein: ENSMUSP00000112949
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138885
SMART Domains Protein: ENSMUSP00000138402
Gene: ENSMUSG00000029518

DomainStartEndE-ValueType
Pfam:Ras 10 42 1e-8 PFAM
Pfam:Miro 10 46 7.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201869
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Ano1 A G 7: 144,597,215 L821P probably damaging Het
Apol10b T A 15: 77,592,149 probably benign Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccar2 A G 14: 70,140,982 S625P probably benign Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cep350 A T 1: 155,900,883 probably null Het
Chd3 A G 11: 69,354,105 V1203A probably damaging Het
Col24a1 A G 3: 145,545,316 probably benign Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
D10Wsu102e A G 10: 83,362,056 D42G probably damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dicer1 A T 12: 104,705,060 S984T probably damaging Het
Diexf A T 1: 193,114,828 probably benign Het
Dmbt1 G A 7: 131,097,673 probably null Het
Dnah7b A T 1: 46,219,544 E1965V probably damaging Het
Dpp4 G T 2: 62,364,988 N315K probably damaging Het
Fam102b G A 3: 108,992,685 R116C probably damaging Het
Fat4 T A 3: 39,002,924 S4256R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gpatch4 A G 3: 88,055,365 D295G probably benign Het
Gpbar1 A T 1: 74,279,392 I265F probably benign Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hacl1 A T 14: 31,622,984 probably benign Het
Hnrnpc A G 14: 52,075,172 probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifnar1 T A 16: 91,501,751 C419S probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Itga2 T G 13: 114,845,856 N1038H probably benign Het
Kif16b C T 2: 142,712,155 D908N probably benign Het
Lamc1 A G 1: 153,246,932 probably benign Het
Lrig3 A G 10: 126,008,736 T690A probably damaging Het
Lrp2 T C 2: 69,511,017 K940E probably damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mrps27 G T 13: 99,409,795 probably benign Het
Ncam1 A G 9: 49,569,818 probably benign Het
Olfr30 T C 11: 58,455,314 I212V possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Pbrm1 T G 14: 31,064,820 D631E probably benign Het
Pdc A T 1: 150,328,414 probably benign Het
Pkd1 T C 17: 24,574,792 S1818P probably damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rerg A T 6: 137,056,307 C123* probably null Het
Ros1 A G 10: 52,194,823 probably benign Het
Siglece A G 7: 43,659,931 Y68H probably damaging Het
Slc28a2 T A 2: 122,458,281 probably null Het
Slc4a11 T C 2: 130,688,157 K234E probably damaging Het
Sqor C T 2: 122,798,050 P158S probably benign Het
Tcerg1 C T 18: 42,522,956 P110S unknown Het
Tm6sf2 T A 8: 70,077,941 Y224N probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Ttll10 T C 4: 156,047,548 probably benign Het
Ubap2l A T 3: 90,009,213 L898Q probably damaging Het
Uggt1 A T 1: 36,159,946 V1207E probably damaging Het
Uhrf2 A G 19: 30,092,776 D775G probably damaging Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn1r87 T G 7: 13,131,656 T235P probably damaging Het
Vmn2r96 T A 17: 18,584,000 M504K probably benign Het
Zdbf2 A T 1: 63,305,290 I943F possibly damaging Het
Zfp78 A G 7: 6,373,158 D22G probably damaging Het
Zfp827 C T 8: 79,179,077 probably null Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Other mutations in Rab35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1858:Rab35 UTSW 5 115640088 missense probably damaging 0.98
R1879:Rab35 UTSW 5 115640160 missense probably damaging 1.00
R4480:Rab35 UTSW 5 115637764 nonsense probably null
R4824:Rab35 UTSW 5 115643395 missense possibly damaging 0.95
R4937:Rab35 UTSW 5 115640088 missense probably damaging 0.96
R6062:Rab35 UTSW 5 115640088 missense probably damaging 0.98
R6126:Rab35 UTSW 5 115645708 missense probably benign 0.00
R8515:Rab35 UTSW 5 115643408 missense probably damaging 0.96
R8554:Rab35 UTSW 5 115645631 critical splice acceptor site probably null
R9256:Rab35 UTSW 5 115640187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTTTCAGCCTTTAATGCCAC -3'
(R):5'- ACGGCACTAAACTGAGACTGTCCC -3'

Sequencing Primer
(F):5'- tagcacggcagaggcag -3'
(R):5'- ACTGAGACTGTCCCCCGAG -3'
Posted On 2013-06-12