Incidental Mutation 'R8554:Rab35'
ID 660015
Institutional Source Beutler Lab
Gene Symbol Rab35
Ensembl Gene ENSMUSG00000029518
Gene Name RAB35, member RAS oncogene family
Synonyms RAB1C, 9530019H02Rik, H-ray
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 115631908-115647736 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to C at 115645631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031492] [ENSMUST00000055408] [ENSMUST00000118576] [ENSMUST00000121746] [ENSMUST00000138885] [ENSMUST00000141976]
AlphaFold Q6PHN9
Predicted Effect probably null
Transcript: ENSMUST00000031492
SMART Domains Protein: ENSMUSP00000031492
Gene: ENSMUSG00000029518

DomainStartEndE-ValueType
RAB 9 171 5.07e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055408
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118576
SMART Domains Protein: ENSMUSP00000112842
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121746
SMART Domains Protein: ENSMUSP00000112949
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138885
SMART Domains Protein: ENSMUSP00000138402
Gene: ENSMUSG00000029518

DomainStartEndE-ValueType
Pfam:Ras 10 42 1e-8 PFAM
Pfam:Miro 10 46 7.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141976
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,296,897 Y94N possibly damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Apc T C 18: 34,312,946 V947A probably damaging Het
Apob A C 12: 7,987,830 K334N probably damaging Het
BC048403 T A 10: 121,740,055 I27N probably benign Het
Camk2d A T 3: 126,770,799 Q119L possibly damaging Het
Ccdc60 A T 5: 116,190,112 F98I probably damaging Het
Cd47 A G 16: 49,867,941 T22A probably benign Het
Crat A G 2: 30,410,023 V115A probably benign Het
Csmd3 T C 15: 47,644,142 M2992V probably benign Het
Dsg4 T A 18: 20,453,043 N263K probably damaging Het
Eln A C 5: 134,710,110 probably benign Het
Ep300 A G 15: 81,639,027 E1284G unknown Het
Fam193a T A 5: 34,475,771 M122K probably benign Het
Fam46a T C 9: 85,326,731 D13G possibly damaging Het
Fam57a A G 11: 76,205,418 H124R probably damaging Het
Fcgr1 A T 3: 96,292,472 W40R probably damaging Het
Gm3486 T A 14: 41,487,162 Q84L probably damaging Het
Gm9513 A G 9: 36,476,492 I25V probably benign Het
Golga2 G A 2: 32,293,345 D80N probably damaging Het
Isg20 T C 7: 78,916,677 Y125H probably benign Het
Kdf1 A G 4: 133,528,877 I302V probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Lrp1b T A 2: 41,344,483 Q1038L probably benign Het
March6 G A 15: 31,482,830 H476Y probably damaging Het
Myom1 A G 17: 71,036,453 E215G possibly damaging Het
Olfr1228 T C 2: 89,249,251 T148A possibly damaging Het
Olfr132 T A 17: 38,130,598 Q198L probably damaging Het
Olfr223 A T 11: 59,589,486 L201Q possibly damaging Het
Pdlim2 T A 14: 70,171,249 T173S probably benign Het
Pitpnb T C 5: 111,346,506 M74T probably benign Het
Pou2f2 C A 7: 25,115,556 probably benign Het
Rasef A T 4: 73,727,607 D508E probably benign Het
Rev3l T C 10: 39,806,842 S319P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgl3 A G 9: 21,988,863 S44P probably benign Het
Rnf214 C A 9: 45,867,499 probably null Het
Rpsa T C 9: 120,129,251 V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Senp7 T C 16: 56,158,610 V529A probably benign Het
Siglecg C T 7: 43,408,896 S69L probably benign Het
Sos1 G T 17: 80,398,413 T1243K probably damaging Het
Tmc2 A G 2: 130,264,164 T872A probably benign Het
Tnfrsf8 A C 4: 145,296,941 C107W probably damaging Het
Tnn T C 1: 160,110,416 Y913C probably damaging Het
Ttn T C 2: 76,738,032 T19179A probably damaging Het
Usp42 T A 5: 143,720,382 K294N probably damaging Het
Vmn1r123 T A 7: 21,163,046 C288S probably benign Het
Vmn1r29 T A 6: 58,308,206 *304K probably null Het
Vmn2r1 T C 3: 64,089,913 I330T probably damaging Het
Vmn2r16 A G 5: 109,364,131 I735V probably benign Het
Vmn2r65 T C 7: 84,946,752 I241M probably benign Het
Other mutations in Rab35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0502:Rab35 UTSW 5 115645664 missense probably benign 0.02
R1858:Rab35 UTSW 5 115640088 missense probably damaging 0.98
R1879:Rab35 UTSW 5 115640160 missense probably damaging 1.00
R4480:Rab35 UTSW 5 115637764 nonsense probably null
R4824:Rab35 UTSW 5 115643395 missense possibly damaging 0.95
R4937:Rab35 UTSW 5 115640088 missense probably damaging 0.96
R6062:Rab35 UTSW 5 115640088 missense probably damaging 0.98
R6126:Rab35 UTSW 5 115645708 missense probably benign 0.00
R8515:Rab35 UTSW 5 115643408 missense probably damaging 0.96
R9256:Rab35 UTSW 5 115640187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGTGTTTTGAGGGCACAC -3'
(R):5'- CGGCACTAAACTGAGACTGTCC -3'

Sequencing Primer
(F):5'- TTTGAGGGCACACAGTTCAC -3'
(R):5'- TAAACTGAGACTGTCCCCCGAG -3'
Posted On 2021-01-18