Incidental Mutation 'R5995:Ofcc1'
ID481082
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
MMRRC Submission 044174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5995 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40280422 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 69 (L69P)
Ref Sequence ENSEMBL: ENSMUSP00000153579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224813] [ENSMUST00000224909]
Predicted Effect probably damaging
Transcript: ENSMUST00000054635
AA Change: L69P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: L69P

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224813
AA Change: L69P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224909
AA Change: L69P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Adgrb2 C A 4: 130,017,103 A1104E probably damaging Het
Adgrv1 A G 13: 81,466,259 V4005A probably benign Het
Bend6 T C 1: 33,878,439 probably null Het
Brwd1 A T 16: 96,064,787 V265E probably damaging Het
Ccdc96 A G 5: 36,486,374 I575V probably damaging Het
Cd109 A T 9: 78,700,279 I1094L probably benign Het
Cd44 A G 2: 102,861,670 V91A probably damaging Het
Cdv3 C G 9: 103,364,003 G122R probably damaging Het
Ces2c T A 8: 104,850,901 V272D possibly damaging Het
Colgalt1 T A 8: 71,623,110 M467K probably damaging Het
Crtam G A 9: 40,994,540 T31M possibly damaging Het
Cyp7a1 C T 4: 6,272,371 V281M possibly damaging Het
Dnah7a A T 1: 53,620,670 N726K probably benign Het
Dok6 T C 18: 89,421,018 E232G possibly damaging Het
Gm12185 T C 11: 48,915,713 E217G probably benign Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gria1 A T 11: 57,289,285 Y618F probably damaging Het
H2-T22 A G 17: 36,041,485 Y183H probably benign Het
Hace1 A T 10: 45,670,391 I374L probably benign Het
Hif3a T A 7: 17,053,769 T132S probably benign Het
Hoxa3 T A 6: 52,170,283 probably benign Het
Il27 A C 7: 126,589,363 probably benign Het
Kdelc2 T C 9: 53,395,895 Y380H probably damaging Het
Klhdc1 T C 12: 69,250,774 Y40H probably damaging Het
Klhl33 T G 14: 50,892,651 E462A possibly damaging Het
Myh10 T C 11: 68,814,983 I1979T probably benign Het
Nfkbil1 G T 17: 35,220,798 F246L probably benign Het
Nlrp1b A T 11: 71,181,746 F424I probably damaging Het
Nod1 A G 6: 54,944,554 Y260H probably damaging Het
Olfr1110 T C 2: 87,135,856 N155S probably damaging Het
Olfr1419 A T 19: 11,870,862 I118N possibly damaging Het
Olfr1446 A C 19: 12,890,597 probably null Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Olfr968 A G 9: 39,772,692 V36A probably benign Het
Olfr98 C A 17: 37,263,648 Q5H probably benign Het
Onecut2 G T 18: 64,341,548 R390L probably damaging Het
Oprm1 A C 10: 6,832,520 M388L probably benign Het
Pcdhgc5 T A 18: 37,821,060 Y462* probably null Het
Pex1 T A 5: 3,607,704 M425K possibly damaging Het
Plec A T 15: 76,185,905 Y1001N probably damaging Het
Pou2f2 T G 7: 25,097,444 K236Q probably damaging Het
Rbm20 G A 19: 53,851,267 E896K possibly damaging Het
Sh3tc2 T A 18: 61,990,010 L614Q probably damaging Het
Skint5 T A 4: 113,893,832 I339F unknown Het
Slc2a7 T C 4: 150,168,340 I479T probably damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Supt20 T C 3: 54,709,053 S245P probably damaging Het
Ttn A G 2: 76,761,292 I21011T probably damaging Het
Vmn2r11 T A 5: 109,047,055 I802F probably damaging Het
Vmn2r92 T C 17: 18,168,951 probably null Het
Ythdc2 T A 18: 44,886,253 M1363K probably damaging Het
Zan T C 5: 137,378,809 probably benign Het
Zfp521 C A 18: 13,717,624 C1261F probably damaging Het
Zfp980 A T 4: 145,701,909 K403* probably null Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
R7589:Ofcc1 UTSW 13 40255484 missense probably benign 0.13
R7792:Ofcc1 UTSW 13 40142826 missense probably damaging 0.99
R7852:Ofcc1 UTSW 13 40180439 missense probably damaging 1.00
R7935:Ofcc1 UTSW 13 40180439 missense probably damaging 1.00
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATCCTCAGCTGCATCAC -3'
(R):5'- TTCTGCTTAGCCCTGGAATC -3'

Sequencing Primer
(F):5'- TGCATCACCCCCAACCCTAG -3'
(R):5'- CTGGAATCCAACAGCCTATTGTGTG -3'
Posted On2017-06-26