Mutagenetix > Incidental Mutations

Incidental Mutation 'R7091:Ofcc1'

550230

Institutional Source

Beutler Lab

Gene Symbol

Ofcc1

Ensembl Gene

ENSMUSG00000047094

Gene Name

orofacial cleft 1 candidate 1

Synonyms

Opo, ojoplano

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40001882-40361450 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40072767 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 763 (I763T)

Ref Sequence

ENSEMBL: ENSMUSP00000062217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054635
AA Change: I763T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: I763T

Domain	Start	End	E-Value	Type
Pfam:OFCC1	5	113	1.3e-57	PFAM
transmembrane domain	575	592	N/A	INTRINSIC
transmembrane domain	599	618	N/A	INTRINSIC
transmembrane domain	633	655	N/A	INTRINSIC
transmembrane domain	667	689	N/A	INTRINSIC
transmembrane domain	721	743	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224909

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Lrp5	A	T	19: 3,630,184	D433E	probably damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Mta1	A	G	12: 113,136,402	D644G	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Nup153	A	T	13: 46,683,928	S1273T	probably benign	Het
Olfr142	T	C	2: 90,252,463	Y175C	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Spag5	T	A	11: 78,313,191		probably null	Het
Tdp2	T	A	13: 24,838,224	F209I	probably damaging	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Ofcc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Ofcc1	APN	13	40142804	missense	probably damaging	0.97
IGL00489:Ofcc1	APN	13	40280491	missense	probably damaging	1.00
IGL01952:Ofcc1	APN	13	40280861	missense	probably damaging	1.00
IGL02126:Ofcc1	APN	13	40208775	missense	probably benign
IGL02619:Ofcc1	APN	13	40097077	missense	possibly damaging	0.68
IGL03069:Ofcc1	APN	13	40072664	missense	probably benign	0.38
IGL03133:Ofcc1	APN	13	40072768	missense	probably benign	0.36
IGL03273:Ofcc1	APN	13	40180525	missense	probably damaging	1.00
IGL03343:Ofcc1	APN	13	40072664	missense	probably benign	0.38
IGL03349:Ofcc1	APN	13	40072752	missense	probably benign	0.13
IGL03399:Ofcc1	APN	13	40142838	missense	possibly damaging	0.56
LCD18:Ofcc1	UTSW	13	40092967	intron	probably benign
R0122:Ofcc1	UTSW	13	40280556	splice site	probably null
R0320:Ofcc1	UTSW	13	40206696	missense	probably benign	0.01
R0386:Ofcc1	UTSW	13	40214474	nonsense	probably null
R0390:Ofcc1	UTSW	13	40015313	missense	possibly damaging	0.85
R0829:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R0866:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R0945:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R0981:Ofcc1	UTSW	13	40072698	missense	probably damaging	1.00
R1055:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1056:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1186:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1187:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1400:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1411:Ofcc1	UTSW	13	40142787	missense	probably benign	0.02
R1419:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1474:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1636:Ofcc1	UTSW	13	40180428	missense	possibly damaging	0.86
R1691:Ofcc1	UTSW	13	40208829	missense	probably benign	0.00
R1886:Ofcc1	UTSW	13	40206624	missense	possibly damaging	0.88
R1887:Ofcc1	UTSW	13	40206624	missense	possibly damaging	0.88
R2176:Ofcc1	UTSW	13	40097119	missense	probably benign
R2189:Ofcc1	UTSW	13	40180448	missense	probably benign
R2242:Ofcc1	UTSW	13	40142787	missense	probably benign	0.02
R2255:Ofcc1	UTSW	13	40094705	missense	probably damaging	0.99
R2471:Ofcc1	UTSW	13	40097025	missense	probably damaging	1.00
R2863:Ofcc1	UTSW	13	40072760	missense	probably damaging	1.00
R2863:Ofcc1	UTSW	13	40087938	missense	possibly damaging	0.56
R4366:Ofcc1	UTSW	13	40015461	missense	probably benign	0.18
R4573:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4574:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4656:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4657:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4673:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4782:Ofcc1	UTSW	13	40001892	synonymous	probably null
R4790:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4823:Ofcc1	UTSW	13	40280473	missense	probably damaging	0.99
R4834:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4840:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4842:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4889:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4919:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4920:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4921:Ofcc1	UTSW	13	40214517	missense	probably benign	0.10
R4948:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4953:Ofcc1	UTSW	13	40015388	missense	probably damaging	1.00
R4961:Ofcc1	UTSW	13	40263559	critical splice donor site	probably null
R5339:Ofcc1	UTSW	13	40087845	missense	probably benign	0.35
R5512:Ofcc1	UTSW	13	40206810	missense	probably benign	0.20
R5566:Ofcc1	UTSW	13	40094653	missense	probably damaging	1.00
R5672:Ofcc1	UTSW	13	40280429	missense	probably damaging	0.98
R5734:Ofcc1	UTSW	13	40087849	missense	probably damaging	1.00
R5839:Ofcc1	UTSW	13	40280545	missense	probably damaging	1.00
R5853:Ofcc1	UTSW	13	40206717	missense	probably benign	0.00
R5896:Ofcc1	UTSW	13	40180584	missense	probably benign	0.01
R5909:Ofcc1	UTSW	13	40263578	missense	possibly damaging	0.92
R5995:Ofcc1	UTSW	13	40280422	missense	probably damaging	1.00
R6306:Ofcc1	UTSW	13	40148576	missense	probably benign
R6460:Ofcc1	UTSW	13	40287979	missense	probably damaging	0.99
R6504:Ofcc1	UTSW	13	40097055	missense	probably damaging	1.00
R6797:Ofcc1	UTSW	13	40087947	missense	possibly damaging	0.75
R7098:Ofcc1	UTSW	13	40003966	critical splice donor site	probably null
R7142:Ofcc1	UTSW	13	40004062	missense	probably benign	0.00
R7240:Ofcc1	UTSW	13	40208841	missense	probably benign
R7589:Ofcc1	UTSW	13	40255484	missense	probably benign	0.13
R7792:Ofcc1	UTSW	13	40142826	missense	probably damaging	0.99
R7852:Ofcc1	UTSW	13	40180439	missense	probably damaging	1.00
R7935:Ofcc1	UTSW	13	40180439	missense	probably damaging	1.00
X0005:Ofcc1	UTSW	13	40142790	missense	probably benign	0.01
X0005:Ofcc1	UTSW	13	40280532	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGCAGTTCTTTTGCACAG -3'
(R):5'- CCAGATTACATTTGTTGGCTTAGAG -3'

Sequencing Primer
(F):5'- CTTTTGCACAGTCAGTCGGGAC -3'
(R):5'- CTCAGCTAAGAAATCCTCTTTT -3'

Posted On

2019-05-15