Incidental Mutation 'R4520:Prkag2'
ID500660
Institutional Source Beutler Lab
Gene Symbol Prkag2
Ensembl Gene ENSMUSG00000028944
Gene Nameprotein kinase, AMP-activated, gamma 2 non-catalytic subunit
Synonyms
MMRRC Submission 041763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4520 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24862744-25100642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24866171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 403 (V403A)
Ref Sequence ENSEMBL: ENSMUSP00000075651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030784] [ENSMUST00000076306] [ENSMUST00000114975] [ENSMUST00000150135]
Predicted Effect probably damaging
Transcript: ENSMUST00000030784
AA Change: V526A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030784
Gene: ENSMUSG00000028944
AA Change: V526A

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
low complexity region 113 122 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
CBS 276 325 7.01e-6 SMART
CBS 357 406 4.28e-10 SMART
CBS 432 480 8.11e-11 SMART
CBS 504 552 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076306
AA Change: V403A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075651
Gene: ENSMUSG00000028944
AA Change: V403A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
CBS 153 202 7.01e-6 SMART
CBS 234 283 4.28e-10 SMART
CBS 309 357 8.11e-11 SMART
CBS 381 429 3.62e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114975
AA Change: V286A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110626
Gene: ENSMUSG00000028944
AA Change: V286A

DomainStartEndE-ValueType
CBS 36 85 7.01e-6 SMART
CBS 117 166 4.28e-10 SMART
CBS 192 240 8.11e-11 SMART
CBS 264 312 3.62e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135525
Predicted Effect probably benign
Transcript: ENSMUST00000150135
SMART Domains Protein: ENSMUSP00000114978
Gene: ENSMUSG00000028944

DomainStartEndE-ValueType
CBS 37 86 7.01e-6 SMART
CBS 118 167 4.28e-10 SMART
CBS 193 241 8.11e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AMP-activated protein kinase (AMPK) is a heterotrimeric protein composed of a catalytic alpha subunit, a noncatalytic beta subunit, and a noncatalytic regulatory gamma subunit. Various forms of each of these subunits exist, encoded by different genes. AMPK is an important energy-sensing enzyme that monitors cellular energy status and functions by inactivating key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This gene is a member of the AMPK gamma subunit family. Mutations in this gene have been associated with Wolff-Parkinson-White syndrome, familial hypertrophic cardiomyopathy, and glycogen storage disease of the heart. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous constitutively active mutants develop age related obesity caused by polyphagia, glucose intolerance and insulin resistance and exhibit slowing of heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,266 T1739A probably damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cel C T 2: 28,557,968 V349M probably benign Het
Cspp1 A G 1: 10,134,227 T1127A probably benign Het
Cyp2b10 T C 7: 25,911,557 V113A probably benign Het
Cyp2c50 A G 19: 40,090,689 T159A probably benign Het
Degs1 T C 1: 182,276,808 D304G possibly damaging Het
Esr2 G A 12: 76,167,549 P43S possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm5444 A G 13: 4,834,226 noncoding transcript Het
Golga3 T A 5: 110,203,751 L790* probably null Het
Gtpbp6 T C 5: 110,107,859 T105A probably benign Het
Ido2 T C 8: 24,576,178 E24G probably damaging Het
Ihh T A 1: 74,950,950 I89F probably damaging Het
Krt13 A G 11: 100,119,348 M269T probably damaging Het
Marf1 T C 16: 14,132,666 H952R probably damaging Het
Mga T A 2: 119,948,098 F2041L possibly damaging Het
Msmo1 A C 8: 64,720,523 probably benign Het
Mterf1a A G 5: 3,890,992 V292A probably damaging Het
Naxe A G 3: 88,057,982 probably null Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr1097 T C 2: 86,891,019 D52G probably benign Het
Olfr572 A T 7: 102,928,557 I310F probably benign Het
Olfr657 T A 7: 104,636,169 V165E probably damaging Het
Otog T A 7: 46,241,053 probably benign Het
Pigo A T 4: 43,020,301 H880Q probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Pole T A 5: 110,297,924 D555E probably damaging Het
Psg28 T A 7: 18,422,901 M470L probably benign Het
Rpgrip1 A G 14: 52,152,289 T1138A probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9c T C 13: 33,151,857 probably null Het
Sh2d6 T C 6: 72,518,953 N101D possibly damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc13a1 T C 6: 24,134,513 T124A probably benign Het
Slc6a3 G A 13: 73,540,856 V100M possibly damaging Het
Sspn A G 6: 145,961,307 T79A probably benign Het
Tlr8 C T X: 167,243,175 R893H probably damaging Het
Tnrc18 T C 5: 142,732,150 K2183R unknown Het
Trim15 T C 17: 36,866,350 I139M probably benign Het
Trmt13 A T 3: 116,581,613 probably null Het
Vmn2r84 T A 10: 130,386,522 T610S probably damaging Het
Zcchc14 A T 8: 121,609,095 probably benign Het
Other mutations in Prkag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Prkag2 APN 5 25021965 missense probably benign 0.01
R0437:Prkag2 UTSW 5 25028505 missense possibly damaging 0.65
R0622:Prkag2 UTSW 5 24869249 missense probably damaging 0.98
R0755:Prkag2 UTSW 5 24947631 missense probably benign 0.25
R1400:Prkag2 UTSW 5 24873918 missense probably damaging 1.00
R1561:Prkag2 UTSW 5 24871595 missense probably damaging 1.00
R1569:Prkag2 UTSW 5 24947477 missense possibly damaging 0.59
R1612:Prkag2 UTSW 5 24877028 missense probably benign 0.06
R1615:Prkag2 UTSW 5 24875178 missense possibly damaging 0.56
R1700:Prkag2 UTSW 5 24871541 missense probably damaging 0.97
R2011:Prkag2 UTSW 5 24871054 critical splice donor site probably null
R2045:Prkag2 UTSW 5 24947582 missense possibly damaging 0.76
R2230:Prkag2 UTSW 5 24908364 missense probably benign 0.10
R2863:Prkag2 UTSW 5 25021792 missense probably benign 0.39
R3104:Prkag2 UTSW 5 24871069 nonsense probably null
R4193:Prkag2 UTSW 5 24878760 missense probably damaging 1.00
R4604:Prkag2 UTSW 5 24878734 missense probably damaging 1.00
R5736:Prkag2 UTSW 5 24878722 missense probably damaging 1.00
R6273:Prkag2 UTSW 5 24947536 missense probably damaging 0.96
R6414:Prkag2 UTSW 5 25100180 start gained probably benign
R6510:Prkag2 UTSW 5 25100288 start gained probably benign
R6511:Prkag2 UTSW 5 25100288 start gained probably benign
R7035:Prkag2 UTSW 5 24947566 missense probably damaging 1.00
R7084:Prkag2 UTSW 5 25021969 missense probably benign
R7211:Prkag2 UTSW 5 24995298 missense probably benign 0.00
R7353:Prkag2 UTSW 5 24880686 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGTTGACCTGGAGCTCACA -3'
(R):5'- TTAACGTAGGGCTGGAGAGAT -3'

Sequencing Primer
(F):5'- AGAAATGCACCTGTCTCTGC -3'
(R):5'- TGGACACAAGTTGGATTCCC -3'
Posted On2017-12-01