Mutagenetix > Incidental Mutations

Incidental Mutation 'R6240:Plk2'

505194

Institutional Source

Beutler Lab

Gene Symbol

Plk2

Ensembl Gene

ENSMUSG00000021701

Gene Name

polo like kinase 2

Synonyms

Snk

MMRRC Submission

044364-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6240 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110395046-110400844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110399474 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 571 (Y571N)

Ref Sequence

ENSEMBL: ENSMUSP00000022212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022212]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022212
AA Change: Y571N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: Y571N

Domain	Start	End	E-Value	Type
low complexity region	54	62	N/A	INTRINSIC
S_TKc	79	331	7.08e-97	SMART
Blast:STYKc	335	383	9e-7	BLAST
low complexity region	448	464	N/A	INTRINSIC
Pfam:POLO_box	508	569	2.5e-19	PFAM
Pfam:POLO_box	604	673	1.3e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223756

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225156

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225340

Meta Mutation Damage Score

0.2252

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	C	A	14: 63,986,252	R25L	probably damaging	Het
9930021J03Rik	A	T	19: 29,717,240	S1618T	probably benign	Het
Adamts1	G	A	16: 85,802,157	S185L	probably benign	Het
Adamts12	A	T	15: 11,285,958	D751V	probably benign	Het
Adgrg3	A	G	8: 95,039,916	D405G	probably benign	Het
Ahi1	A	G	10: 20,977,081	D516G	probably damaging	Het
Ahnak	A	T	19: 9,013,583	D4077V	probably damaging	Het
Arhgef18	G	A	8: 3,439,658	R330Q	probably damaging	Het
Arid1a	A	G	4: 133,680,686	V2170A	unknown	Het
Asxl3	C	T	18: 22,465,508	L227F	probably damaging	Het
B3glct	A	G	5: 149,726,788	I119V	probably benign	Het
Cad	T	A	5: 31,072,978	M1512K	probably benign	Het
Cdc25a	A	G	9: 109,884,158	T172A	probably damaging	Het
Cdh18	A	G	15: 23,226,936	D161G	possibly damaging	Het
Clmp	A	G	9: 40,782,411	N308S	probably damaging	Het
Dlg5	A	T	14: 24,149,528		probably null	Het
Dscam	G	A	16: 96,619,502	T1728M	probably damaging	Het
E4f1	A	G	17: 24,444,582	S524P	possibly damaging	Het
Epha5	G	C	5: 84,117,579	A452G	probably benign	Het
Fzd3	T	C	14: 65,209,855	T542A	probably damaging	Het
Glyctk	A	T	9: 106,156,262		probably null	Het
Gm10382	G	A	5: 125,389,596		probably benign	Het
Gm8765	G	A	13: 50,701,417	D364N	probably damaging	Het
Hnmt	T	A	2: 24,014,269	M127L	probably benign	Het
Hoxc10	T	A	15: 102,970,830	W262R	probably damaging	Het
Icam5	T	A	9: 21,033,158	W52R	possibly damaging	Het
Jazf1	A	T	6: 52,777,552	C180S	probably damaging	Het
Kcnk2	A	G	1: 189,242,982	W286R	probably damaging	Het
Kcnmb2	C	T	3: 32,181,896	S98F	probably damaging	Het
Mob3a	C	G	10: 80,689,864	E204D	possibly damaging	Het
Morc3	C	G	16: 93,862,684	H459D	probably damaging	Het
Mroh2b	A	T	15: 4,934,644	N876I	probably benign	Het
Myo16	A	T	8: 10,370,930	T257S	probably damaging	Het
Nat1	A	T	8: 67,491,702	R243S	possibly damaging	Het
Nudt9	T	C	5: 104,047,089	V17A	probably benign	Het
Olfr1205	A	G	2: 88,831,363	D82G	probably benign	Het
Olfr1216	A	G	2: 89,013,626	I146T	probably benign	Het
Olfr1340	A	G	4: 118,726,471	S75G	probably benign	Het
Olfr734	A	G	14: 50,320,586	V83A	probably benign	Het
Olfr814	C	A	10: 129,874,677	V27L	probably benign	Het
Pcdh7	T	C	5: 57,721,362	L753P	probably damaging	Het
Pcf11	T	A	7: 92,646,502	E1446D	probably damaging	Het
Pepd	A	G	7: 35,021,751	I267V	probably benign	Het
Prag1	T	C	8: 36,103,352	L363P	probably benign	Het
Psmd3	A	G	11: 98,693,653	T387A	probably damaging	Het
Ptgs1	G	A	2: 36,237,285	C61Y	probably damaging	Het
Rab18	T	C	18: 6,784,635	Y109H	probably benign	Het
Robo2	G	A	16: 73,982,139	P358L	probably damaging	Het
Smarcc2	C	T	10: 128,488,024		probably benign	Het
Srgap1	A	G	10: 122,047,156	I13T	probably benign	Het
Tcf12	T	A	9: 71,944,016	K110*	probably null	Het
Tdrd1	T	C	19: 56,841,335	S214P	probably benign	Het
Tdrd3	T	A	14: 87,505,886	N417K	probably damaging	Het
Tmem255b	A	G	8: 13,454,216	Y136C	probably damaging	Het
Tmem63c	A	T	12: 87,076,405	I448F	possibly damaging	Het
Tnpo1	T	C	13: 98,863,829	I335M	probably damaging	Het
Vmn1r1	T	C	1: 182,157,621	T160A	probably damaging	Het
Vmn1r203	A	G	13: 22,524,729	N227D	possibly damaging	Het
Vmn2r6	T	A	3: 64,556,805	S203C	probably damaging	Het
Zfp628	A	G	7: 4,919,849	T357A	possibly damaging	Het
Zfp872	A	G	9: 22,199,884	K220E	probably damaging	Het

Other mutations in Plk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Plk2	APN	13	110398764	missense	probably benign	0.18
IGL00586:Plk2	APN	13	110396378	missense	possibly damaging	0.61
IGL00798:Plk2	APN	13	110398034	missense	probably benign	0.00
IGL01450:Plk2	APN	13	110396324	missense	probably damaging	1.00
IGL01722:Plk2	APN	13	110399442	missense	probably benign	0.00
IGL01937:Plk2	APN	13	110399054	missense	possibly damaging	0.80
IGL01945:Plk2	APN	13	110399054	missense	possibly damaging	0.80
IGL01993:Plk2	APN	13	110399197	missense	probably damaging	1.00
IGL02231:Plk2	APN	13	110400069	missense	probably benign	0.01
IGL03059:Plk2	APN	13	110399134	missense	probably benign	0.42
Mite	UTSW	13	110396036	nonsense	probably null
R0189:Plk2	UTSW	13	110399463	missense	probably damaging	1.00
R0324:Plk2	UTSW	13	110397708	missense	probably benign	0.08
R1108:Plk2	UTSW	13	110399489	missense	probably damaging	0.99
R1422:Plk2	UTSW	13	110399489	missense	probably damaging	0.99
R1513:Plk2	UTSW	13	110400088	missense	probably benign	0.45
R2987:Plk2	UTSW	13	110397709	missense	probably benign	0.03
R4050:Plk2	UTSW	13	110399866	missense	probably damaging	1.00
R4211:Plk2	UTSW	13	110396337	missense	probably damaging	0.98
R4278:Plk2	UTSW	13	110396103	missense	probably benign	0.15
R4777:Plk2	UTSW	13	110397773	missense	probably benign
R5121:Plk2	UTSW	13	110399424	missense	probably benign	0.01
R5677:Plk2	UTSW	13	110399057	missense	possibly damaging	0.83
R6240:Plk2	UTSW	13	110400034	missense	probably damaging	1.00
R6436:Plk2	UTSW	13	110396036	nonsense	probably null
R6596:Plk2	UTSW	13	110397762	missense	probably benign	0.37
R6776:Plk2	UTSW	13	110399791	missense	probably benign
R6938:Plk2	UTSW	13	110396680	nonsense	probably null
R7556:Plk2	UTSW	13	110396588	splice site	probably null
Z1177:Plk2	UTSW	13	110395259	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGTTGCGCTAATGAAATCTTGG -3'
(R):5'- CACCGTGCCTCTCAAACTTAAG -3'

Sequencing Primer
(F):5'- CTTGGAAACAGTGATGAATTGCTGC -3'
(R):5'- GATTCCTGGCTCTATCTCAAAGAG -3'

Posted On

2018-02-28