Incidental Mutation 'R6372:Ccdc183'
ID513553
Institutional Source Beutler Lab
Gene Symbol Ccdc183
Ensembl Gene ENSMUSG00000026940
Gene Namecoiled-coil domain containing 183
SynonymsCccd183, 4921530D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6372 (G1)
Quality Score219.009
Status Validated
Chromosome2
Chromosomal Location25608635-25617678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25616164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000028309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028309] [ENSMUST00000142087]
Predicted Effect probably benign
Transcript: ENSMUST00000028308
SMART Domains Protein: ENSMUSP00000028308
Gene: ENSMUSG00000026939

DomainStartEndE-ValueType
Pfam:TMEM141 6 94 1.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028309
AA Change: D140G

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028309
Gene: ENSMUSG00000026940
AA Change: D140G

DomainStartEndE-ValueType
coiled coil region 118 147 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
coiled coil region 321 406 N/A INTRINSIC
low complexity region 524 534 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136952
Predicted Effect probably benign
Transcript: ENSMUST00000142087
SMART Domains Protein: ENSMUSP00000121862
Gene: ENSMUSG00000026939

DomainStartEndE-ValueType
Pfam:TMEM141 2 97 1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155684
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,230,226 H136Q possibly damaging Het
3110035E14Rik G A 1: 9,613,321 E45K probably damaging Het
Aim2 T A 1: 173,455,236 probably null Het
Atp13a3 T C 16: 30,343,455 H696R probably damaging Het
Atrnl1 T C 19: 57,650,332 S301P probably benign Het
Atxn1 T A 13: 45,557,456 I667F probably damaging Het
Cacnb4 T A 2: 52,434,667 Y415F probably benign Het
Clec2g A C 6: 128,948,763 H45P probably benign Het
Col5a3 A G 9: 20,785,586 V917A probably damaging Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Dnajc28 T C 16: 91,617,288 I23V probably benign Het
Elovl6 T C 3: 129,633,102 F139S probably damaging Het
Fcgbp A G 7: 28,107,008 T2134A probably damaging Het
Fcrl5 C T 3: 87,444,194 Q250* probably null Het
Gimap1 T A 6: 48,743,356 *301K probably null Het
Gm17472 T C 6: 42,980,889 S31P possibly damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gnl1 T C 17: 35,982,535 F204S probably damaging Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hk1 T C 10: 62,291,978 H370R probably benign Het
Ighv7-2 G A 12: 113,912,455 T10I probably benign Het
Itga9 A G 9: 118,897,321 K448E probably damaging Het
Lama4 C A 10: 39,067,952 N750K probably benign Het
Megf11 T C 9: 64,706,625 Y1077H probably damaging Het
Mrpl45 T C 11: 97,321,562 probably benign Het
Nbeal2 T C 9: 110,628,744 D2185G possibly damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nlrc5 T C 8: 94,479,750 L743P probably damaging Het
Nol4 A G 18: 23,038,556 probably null Het
Nol9 T C 4: 152,045,995 S329P probably damaging Het
Ntrk1 T C 3: 87,786,048 D259G probably benign Het
Olfr1039 T C 2: 86,130,854 T270A possibly damaging Het
Olfr1098 T A 2: 86,923,155 I126F probably damaging Het
Olfr1155 T C 2: 87,942,975 T218A probably benign Het
Olfr1286 T A 2: 111,420,802 I50F probably benign Het
Olfr1381 A G 11: 49,551,930 Y61C probably damaging Het
Pbx4 C A 8: 69,872,044 A365E possibly damaging Het
Pcdhb19 T A 18: 37,497,366 N71K probably benign Het
Pde2a G A 7: 101,481,392 A80T probably benign Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Recql A G 6: 142,376,840 V112A probably damaging Het
Rhbdl3 C A 11: 80,330,656 L207I probably damaging Het
Rtkn A G 6: 83,151,901 D459G possibly damaging Het
Rubcnl C A 14: 75,047,569 S509R probably damaging Het
Slc26a8 T C 17: 28,644,803 T661A probably benign Het
Sspo A T 6: 48,472,541 D2472V probably damaging Het
Taf4b T G 18: 14,804,733 V258G probably damaging Het
Tbc1d19 T G 5: 53,856,910 S293R possibly damaging Het
Tecpr1 C T 5: 144,216,958 R159Q probably damaging Het
Tlr3 A G 8: 45,397,011 S874P probably damaging Het
Tnk2 T A 16: 32,679,785 W639R probably damaging Het
Tpmt C T 13: 47,035,894 probably null Het
Trappc9 T A 15: 72,590,074 D935V possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,661 V4A probably damaging Het
Ubn1 C T 16: 5,081,638 T1082I possibly damaging Het
Usf2 G A 7: 30,955,313 Q35* probably null Het
Vmn1r57 T C 7: 5,220,827 M117T possibly damaging Het
Vmn2r65 G T 7: 84,940,653 A685E probably damaging Het
Zeb2 T C 2: 45,002,539 E166G probably damaging Het
Zfp808 T C 13: 62,172,477 S507P probably damaging Het
Other mutations in Ccdc183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ccdc183 APN 2 25609771 missense probably benign 0.01
IGL02177:Ccdc183 APN 2 25612083 missense probably benign 0.03
R1354:Ccdc183 UTSW 2 25612139 missense probably benign 0.33
R1547:Ccdc183 UTSW 2 25609350 missense probably benign 0.05
R5084:Ccdc183 UTSW 2 25608790 missense probably damaging 0.97
R5579:Ccdc183 UTSW 2 25615422 missense possibly damaging 0.92
R6188:Ccdc183 UTSW 2 25609752 missense probably benign 0.28
R6224:Ccdc183 UTSW 2 25610582 missense possibly damaging 0.55
R6994:Ccdc183 UTSW 2 25617045 missense probably benign 0.00
R7041:Ccdc183 UTSW 2 25613670 missense probably benign 0.00
R7132:Ccdc183 UTSW 2 25616530 critical splice donor site probably null
R7177:Ccdc183 UTSW 2 25616284 missense probably damaging 1.00
R7432:Ccdc183 UTSW 2 25609457 missense probably benign
R7561:Ccdc183 UTSW 2 25611517 missense probably benign 0.00
R8283:Ccdc183 UTSW 2 25612148 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCGCCCTTATAACAGAGTC -3'
(R):5'- ACCTCTTGCTTCTCAGTGGG -3'

Sequencing Primer
(F):5'- CCTTATAACAGAGTCCTTGTCTGAAG -3'
(R):5'- AGCCTGCTACCTTCCTGGG -3'
Posted On2018-04-27