Incidental Mutation 'R6399:Ndrg3'
ID516092
Institutional Source Beutler Lab
Gene Symbol Ndrg3
Ensembl Gene ENSMUSG00000027634
Gene NameN-myc downstream regulated gene 3
Synonyms4833415O14Rik, Ndr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6399 (G1)
Quality Score185.009
Status Validated
Chromosome2
Chromosomal Location156927345-156992056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 156940374 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 191 (A191P)
Ref Sequence ENSEMBL: ENSMUSP00000072144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069600] [ENSMUST00000072298] [ENSMUST00000109558]
Predicted Effect probably benign
Transcript: ENSMUST00000069600
AA Change: A191P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000070052
Gene: ENSMUSG00000027634
AA Change: A191P

DomainStartEndE-ValueType
Pfam:Ndr 32 317 1.1e-129 PFAM
low complexity region 335 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072298
AA Change: A191P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072144
Gene: ENSMUSG00000027634
AA Change: A191P

DomainStartEndE-ValueType
Pfam:Ndr 32 317 1.9e-129 PFAM
Pfam:Abhydrolase_6 58 305 1.6e-13 PFAM
low complexity region 322 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109558
AA Change: A191P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105185
Gene: ENSMUSG00000027634
AA Change: A191P

DomainStartEndE-ValueType
Pfam:Ndr 32 252 1.8e-99 PFAM
Pfam:Abhydrolase_6 55 237 6.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156491
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,647,559 C569R probably damaging Het
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Msh6 T A 17: 87,986,891 S1025T probably damaging Het
Olfr259 C T 2: 87,107,986 V134I probably benign Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Serpinb9g A T 13: 33,492,851 L205F probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Trak1 A G 9: 121,453,496 probably null Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in Ndrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Ndrg3 APN 2 156950032 critical splice donor site probably null
R0277:Ndrg3 UTSW 2 156934935 utr 3 prime probably benign
R1335:Ndrg3 UTSW 2 156946008 splice site probably benign
R1370:Ndrg3 UTSW 2 156938650 missense probably damaging 1.00
R3236:Ndrg3 UTSW 2 156944037 missense probably damaging 0.97
R3401:Ndrg3 UTSW 2 156948288 missense probably damaging 1.00
R3403:Ndrg3 UTSW 2 156948288 missense probably damaging 1.00
R3522:Ndrg3 UTSW 2 156944027 missense probably damaging 0.99
R4282:Ndrg3 UTSW 2 156948294 missense possibly damaging 0.80
R5256:Ndrg3 UTSW 2 156931205 unclassified probably benign
R5894:Ndrg3 UTSW 2 156928778 missense probably benign 0.13
R7781:Ndrg3 UTSW 2 156928813 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTGCCAAGATCCGTGAG -3'
(R):5'- TAGTGGACAGCCTGTGAAATAC -3'

Sequencing Primer
(F):5'- CATGCTCTTTGCAGGATC -3'
(R):5'- AGACAGGGTTTCTCTGTATAGCCC -3'
Posted On2018-05-04