Incidental Mutation 'R6399:Olfr259'
ID516090
Institutional Source Beutler Lab
Gene Symbol Olfr259
Ensembl Gene ENSMUSG00000075160
Gene Nameolfactory receptor 259
SynonymsGA_x6K02T2N869-1820-882, MOR172-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6399 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87104578-87114567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87107986 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 134 (V134I)
Ref Sequence ENSEMBL: ENSMUSP00000151207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099862] [ENSMUST00000213978] [ENSMUST00000215828] [ENSMUST00000216088]
Predicted Effect probably benign
Transcript: ENSMUST00000099862
AA Change: V134I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097448
Gene: ENSMUSG00000075160
AA Change: V134I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-53 PFAM
Pfam:7tm_1 41 290 5.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213978
AA Change: V134I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000215828
AA Change: V134I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216088
AA Change: V134I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,647,559 C569R probably damaging Het
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Msh6 T A 17: 87,986,891 S1025T probably damaging Het
Ndrg3 C G 2: 156,940,374 A191P probably damaging Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Serpinb9g A T 13: 33,492,851 L205F probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Trak1 A G 9: 121,453,496 probably null Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in Olfr259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Olfr259 APN 2 87107441 utr 3 prime probably benign
IGL02540:Olfr259 APN 2 87108042 missense probably damaging 1.00
IGL02572:Olfr259 APN 2 87108366 missense possibly damaging 0.63
R2091:Olfr259 UTSW 2 87108262 missense probably damaging 1.00
R2928:Olfr259 UTSW 2 87107763 missense possibly damaging 0.88
R4107:Olfr259 UTSW 2 87107655 missense probably damaging 1.00
R4332:Olfr259 UTSW 2 87107745 missense possibly damaging 0.79
R4929:Olfr259 UTSW 2 87108183 missense possibly damaging 0.79
R5027:Olfr259 UTSW 2 87107806 missense probably benign 0.40
R6005:Olfr259 UTSW 2 87108063 missense probably benign 0.00
R6191:Olfr259 UTSW 2 87107952 missense probably damaging 1.00
R6358:Olfr259 UTSW 2 87108434 start gained probably benign
R6554:Olfr259 UTSW 2 87107626 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCAGAGCATGCAAGCTTCAAAAG -3'
(R):5'- TCAGCTTCATACCCCAATGTAC -3'

Sequencing Primer
(F):5'- CTTCAAAAGAGGAGGAACATCAC -3'
(R):5'- GACATCTGCTATTCTACAATCATTGC -3'
Posted On2018-05-04