Incidental Mutation 'R6448:Ncbp2'
ID519267
Institutional Source Beutler Lab
Gene Symbol Ncbp2
Ensembl Gene ENSMUSG00000022774
Gene Namenuclear cap binding protein subunit 2
Synonyms20kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6448 (G1)
Quality Score217.468
Status Validated
Chromosome16
Chromosomal Location31948513-31961781 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGTCTGGATG to CG at 31956343 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000231360]
Predicted Effect probably null
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000231360
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 A T 12: 52,517,663 K472N probably benign Het
C2 T G 17: 34,863,359 D298A possibly damaging Het
Col16a1 T G 4: 130,058,988 L409R probably damaging Het
Dlgap1 A G 17: 70,593,330 E380G possibly damaging Het
Fam111a C A 19: 12,588,337 H483Q probably benign Het
Fancc C T 13: 63,340,428 R246Q probably damaging Het
Glb1 A T 9: 114,434,431 Q256L probably damaging Het
Gm9195 A T 14: 72,434,011 D2611E possibly damaging Het
Gsto1 C T 19: 47,857,981 T89I probably benign Het
Hmcn2 A G 2: 31,420,820 S3359G probably benign Het
Hook3 T A 8: 26,093,664 N87I probably benign Het
Htt T A 5: 34,875,992 M1868K probably benign Het
Ighv1-19 T C 12: 114,708,676 E107G probably damaging Het
Il20rb A T 9: 100,474,933 M48K probably benign Het
Inpp5j T C 11: 3,495,387 H822R probably damaging Het
Kif14 G T 1: 136,503,347 V1161F probably damaging Het
Klhdc2 T A 12: 69,303,920 D169E probably benign Het
Ly75 A G 2: 60,299,045 probably null Het
Myh15 T G 16: 49,171,932 S1590A probably damaging Het
Neb T C 2: 52,148,814 D6748G probably damaging Het
Nfrkb T C 9: 31,394,789 Y142H probably damaging Het
Olfr1051 T A 2: 86,276,347 I47F probably benign Het
Olfr1355 G A 10: 78,879,682 C170Y possibly damaging Het
Olfr784 A T 10: 129,388,152 D173V probably damaging Het
Prm2 G A 16: 10,791,961 probably benign Het
Ralgapa1 T C 12: 55,719,661 T1283A probably benign Het
Rest T C 5: 77,281,471 L579P possibly damaging Het
Slc6a1 C T 6: 114,302,086 T46I possibly damaging Het
Tcf20 A G 15: 82,852,660 I1530T probably benign Het
Tox T G 4: 6,822,975 D114A probably benign Het
Ulk4 C T 9: 121,103,630 G1048D probably damaging Het
Other mutations in Ncbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Ncbp2 APN 16 31954153 missense probably damaging 1.00
R1929:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2185:Ncbp2 UTSW 16 31956377 missense probably damaging 1.00
R2270:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2271:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2272:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R6405:Ncbp2 UTSW 16 31956343 frame shift probably null
R6406:Ncbp2 UTSW 16 31956341 frame shift probably null
R6406:Ncbp2 UTSW 16 31956343 frame shift probably null
R6444:Ncbp2 UTSW 16 31956343 frame shift probably null
R6446:Ncbp2 UTSW 16 31956343 frame shift probably null
R6530:Ncbp2 UTSW 16 31956343 frame shift probably null
R6531:Ncbp2 UTSW 16 31956343 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGAAGTCGTGTTAGAC -3'
(R):5'- CACTAACAAGCACAAGTTCCTT -3'

Sequencing Primer
(F):5'- CCAGAAGTCGTGTTAGACCAACTTTG -3'
(R):5'- TAACAAGCACAAGTTCCTTACAAAAG -3'
Posted On2018-05-24