Incidental Mutation 'R6530:Ncbp2'
ID 522297
Institutional Source Beutler Lab
Gene Symbol Ncbp2
Ensembl Gene ENSMUSG00000022774
Gene Name nuclear cap binding protein subunit 2
Synonyms 20kDa
MMRRC Submission 044656-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6530 (G1)
Quality Score 217.468
Status Validated
Chromosome 16
Chromosomal Location 31767364-31777290 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CGTCTGGATG to CG at 31775161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000231360]
AlphaFold Q9CQ49
Predicted Effect probably null
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000231360
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,746,039 (GRCm39) L74P possibly damaging Het
Adamtsl4 T C 3: 95,588,364 (GRCm39) T575A probably benign Het
Adck5 T G 15: 76,478,047 (GRCm39) D224E probably benign Het
Asic4 A G 1: 75,448,979 (GRCm39) N376S probably damaging Het
Atl3 T A 19: 7,499,499 (GRCm39) D254E probably benign Het
Cacnb2 G T 2: 14,979,978 (GRCm39) A274S probably damaging Het
Car2 T C 3: 14,961,791 (GRCm39) V159A probably benign Het
Ccdc138 G C 10: 58,380,790 (GRCm39) G474R probably damaging Het
Coq7 T C 7: 118,124,558 (GRCm39) T203A probably benign Het
Dnah12 T C 14: 26,456,865 (GRCm39) I877T probably damaging Het
Dnah7a C T 1: 53,542,856 (GRCm39) R2438H probably benign Het
Efhc1 T A 1: 21,031,366 (GRCm39) probably null Het
Fbn1 G A 2: 125,231,190 (GRCm39) R459C probably damaging Het
Fer1l4 A G 2: 155,889,785 (GRCm39) probably null Het
Gm5114 G A 7: 39,057,514 (GRCm39) P702S probably damaging Het
Inpp5f T A 7: 128,265,802 (GRCm39) Y182* probably null Het
Irf6 C T 1: 192,839,657 (GRCm39) T44M probably damaging Het
Loxhd1 A G 18: 77,499,847 (GRCm39) N87S probably benign Het
Mtrf1 A T 14: 79,640,331 (GRCm39) Q162L possibly damaging Het
Myoz3 G T 18: 60,712,592 (GRCm39) probably null Het
Nkd2 C T 13: 73,970,809 (GRCm39) G258R probably null Het
Or8k27 A C 2: 86,275,826 (GRCm39) S167A probably benign Het
Parg T C 14: 31,931,156 (GRCm39) S176P probably damaging Het
Prdm2 A C 4: 142,860,617 (GRCm39) V891G probably benign Het
Rasl10a T A 11: 5,008,367 (GRCm39) I21N probably damaging Het
Reg4 T C 3: 98,132,148 (GRCm39) V20A probably benign Het
Shprh T A 10: 11,070,011 (GRCm39) S1462R probably benign Het
Spmip1 G A 6: 29,471,950 (GRCm39) probably null Het
Sult1e1 T C 5: 87,724,147 (GRCm39) E270G probably benign Het
Trpm7 A C 2: 126,654,631 (GRCm39) F1436V probably damaging Het
Ttc33 A G 15: 5,241,603 (GRCm39) probably null Het
Ucp2 A T 7: 100,147,430 (GRCm39) E161D probably benign Het
Vmn2r79 T C 7: 86,651,252 (GRCm39) F217S possibly damaging Het
Wdr93 G A 7: 79,405,741 (GRCm39) A207T probably damaging Het
Zbed6 A G 1: 133,586,939 (GRCm39) S133P probably damaging Het
Zfp949 T C 9: 88,449,340 (GRCm39) probably null Het
Other mutations in Ncbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Ncbp2 APN 16 31,772,971 (GRCm39) missense probably damaging 1.00
R1929:Ncbp2 UTSW 16 31,775,769 (GRCm39) missense probably damaging 0.99
R2185:Ncbp2 UTSW 16 31,775,195 (GRCm39) missense probably damaging 1.00
R2270:Ncbp2 UTSW 16 31,775,769 (GRCm39) missense probably damaging 0.99
R2271:Ncbp2 UTSW 16 31,775,769 (GRCm39) missense probably damaging 0.99
R2272:Ncbp2 UTSW 16 31,775,769 (GRCm39) missense probably damaging 0.99
R6405:Ncbp2 UTSW 16 31,775,161 (GRCm39) frame shift probably null
R6406:Ncbp2 UTSW 16 31,775,161 (GRCm39) frame shift probably null
R6406:Ncbp2 UTSW 16 31,775,159 (GRCm39) frame shift probably null
R6444:Ncbp2 UTSW 16 31,775,161 (GRCm39) frame shift probably null
R6446:Ncbp2 UTSW 16 31,775,161 (GRCm39) frame shift probably null
R6448:Ncbp2 UTSW 16 31,775,161 (GRCm39) frame shift probably null
R6531:Ncbp2 UTSW 16 31,775,161 (GRCm39) frame shift probably null
R9556:Ncbp2 UTSW 16 31,775,758 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGAAGTCGTGTTAGACCA -3'
(R):5'- CACTAACAAGCACAAGTTCCTT -3'

Sequencing Primer
(F):5'- CCAGAAGTCGTGTTAGACCAACTTTG -3'
(R):5'- TAACAAGCACAAGTTCCTTACAAAAG -3'
Posted On 2018-06-06