Incidental Mutation 'R6503:Mettl18'
ID519837
Institutional Source Beutler Lab
Gene Symbol Mettl18
Ensembl Gene ENSMUSG00000041396
Gene Namemethyltransferase like 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6503 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location163994889-163997243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163997118 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 336 (V336A)
Ref Sequence ENSEMBL: ENSMUSP00000107116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045694] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000111490] [ENSMUST00000160926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045694
AA Change: V336A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048636
Gene: ENSMUSG00000041396
AA Change: V336A

DomainStartEndE-ValueType
Pfam:Methyltransf_16 150 233 7.3e-7 PFAM
Pfam:PrmA 166 240 2.1e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111490
AA Change: V336A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107116
Gene: ENSMUSG00000041396
AA Change: V336A

DomainStartEndE-ValueType
Pfam:MTS 147 232 4.5e-6 PFAM
Pfam:Methyltransf_16 149 233 3.6e-7 PFAM
Pfam:PrmA 166 238 2.7e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162949
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G T 7: 79,097,832 A784S probably benign Het
Anxa4 A G 6: 86,744,667 S204P probably damaging Het
Arhgef7 A G 8: 11,833,054 N625D possibly damaging Het
Cage1 G A 13: 38,025,449 T78I possibly damaging Het
Dnaaf2 A T 12: 69,197,511 C259S probably benign Het
Enah C T 1: 181,918,511 G402R probably damaging Het
Epha6 T A 16: 60,205,621 H486L possibly damaging Het
Fat4 A G 3: 38,982,257 M3353V probably benign Het
Gm8882 C A 6: 132,361,692 G188* probably null Het
Gulp1 A T 1: 44,773,380 Q170L probably damaging Het
Jag1 C T 2: 137,101,629 G216S probably damaging Het
Krt8 T A 15: 101,997,934 Y380F possibly damaging Het
Mettl11b T A 1: 163,704,146 D146V probably damaging Het
Oas1e T C 5: 120,787,977 D342G probably benign Het
Olfr1248 A G 2: 89,617,578 S205P possibly damaging Het
Parp10 G A 15: 76,242,484 R195C probably damaging Het
Pcdha1 G A 18: 36,931,671 V463M probably damaging Het
Rb1 T C 14: 73,205,880 I778V probably benign Het
Sacs T A 14: 61,211,361 S3619T probably benign Het
St18 A T 1: 6,795,397 D33V probably damaging Het
Stag3 T C 5: 138,304,420 S1014P probably damaging Het
Syngap1 A G 17: 26,944,684 D40G probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem131l A G 3: 83,940,944 S300P probably benign Het
Other mutations in Mettl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Mettl18 APN 1 163996226 missense possibly damaging 0.83
IGL01989:Mettl18 APN 1 163996303 missense probably benign 0.00
R0190:Mettl18 UTSW 1 163996422 missense probably damaging 0.98
R0394:Mettl18 UTSW 1 163996341 missense probably benign
R0562:Mettl18 UTSW 1 163996493 missense probably benign 0.04
R2260:Mettl18 UTSW 1 163996825 missense probably benign 0.28
R4293:Mettl18 UTSW 1 163996602 missense probably damaging 1.00
R4626:Mettl18 UTSW 1 163996476 missense probably damaging 1.00
R4749:Mettl18 UTSW 1 163996785 missense probably benign 0.13
R5930:Mettl18 UTSW 1 163997177 missense probably null 0.00
R5987:Mettl18 UTSW 1 163996775 missense probably benign 0.04
R6687:Mettl18 UTSW 1 163996800 missense possibly damaging 0.73
R6730:Mettl18 UTSW 1 163997181 missense probably damaging 1.00
R7457:Mettl18 UTSW 1 163996761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCTCATTCTCACTTCAGAAAC -3'
(R):5'- TGAGGCTACTACTTCTATACTTTGC -3'

Sequencing Primer
(F):5'- CACTTCAGAAACCATTTATAATCCGG -3'
(R):5'- AAAAACACCAAACCGTAATTTCAG -3'
Posted On2018-06-06