Mutagenetix > Incidental Mutations

Incidental Mutation 'R6503:Epha6'

519856

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6503 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 60205621 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 486 (H486L)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068860
AA Change: H486L

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: H486L

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	T	7: 79,097,832	A784S	probably benign	Het
Anxa4	A	G	6: 86,744,667	S204P	probably damaging	Het
Arhgef7	A	G	8: 11,833,054	N625D	possibly damaging	Het
Cage1	G	A	13: 38,025,449	T78I	possibly damaging	Het
Dnaaf2	A	T	12: 69,197,511	C259S	probably benign	Het
Enah	C	T	1: 181,918,511	G402R	probably damaging	Het
Fat4	A	G	3: 38,982,257	M3353V	probably benign	Het
Gm8882	C	A	6: 132,361,692	G188*	probably null	Het
Gulp1	A	T	1: 44,773,380	Q170L	probably damaging	Het
Jag1	C	T	2: 137,101,629	G216S	probably damaging	Het
Krt8	T	A	15: 101,997,934	Y380F	possibly damaging	Het
Mettl11b	T	A	1: 163,704,146	D146V	probably damaging	Het
Mettl18	T	C	1: 163,997,118	V336A	possibly damaging	Het
Oas1e	T	C	5: 120,787,977	D342G	probably benign	Het
Olfr1248	A	G	2: 89,617,578	S205P	possibly damaging	Het
Parp10	G	A	15: 76,242,484	R195C	probably damaging	Het
Pcdha1	G	A	18: 36,931,671	V463M	probably damaging	Het
Rb1	T	C	14: 73,205,880	I778V	probably benign	Het
Sacs	T	A	14: 61,211,361	S3619T	probably benign	Het
St18	A	T	1: 6,795,397	D33V	probably damaging	Het
Stag3	T	C	5: 138,304,420	S1014P	probably damaging	Het
Syngap1	A	G	17: 26,944,684	D40G	probably benign	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmem131l	A	G	3: 83,940,944	S300P	probably benign	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00
R8794:Epha6	UTSW	16	60205672	missense	probably benign	0.00
R8926:Epha6	UTSW	16	59839299	missense	probably benign	0.11
R9166:Epha6	UTSW	16	60604875	missense	probably benign	0.00
R9265:Epha6	UTSW	16	59655754	missense	probably damaging	1.00
R9322:Epha6	UTSW	16	60424755	missense	probably damaging	1.00
Z1188:Epha6	UTSW	16	59654090	missense	probably damaging	1.00
Z1189:Epha6	UTSW	16	59654090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCAGCCATACTGCTTAGG -3'
(R):5'- CTTCAGCTCCTAGAAATGTGGC -3'

Sequencing Primer
(F):5'- CTGCGAGTCAATTTTGAGAGAATAGC -3'
(R):5'- CAGCTCCTAGAAATGTGGCTTTTAAC -3'

Posted On

2018-06-06