Incidental Mutation 'R0394:Mettl18'
ID31830
Institutional Source Beutler Lab
Gene Symbol Mettl18
Ensembl Gene ENSMUSG00000041396
Gene Namemethyltransferase like 18
Synonyms
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163994889-163997243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163996341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000107116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045694] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000111490] [ENSMUST00000160926]
Predicted Effect probably benign
Transcript: ENSMUST00000045694
AA Change: D77G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048636
Gene: ENSMUSG00000041396
AA Change: D77G

DomainStartEndE-ValueType
Pfam:Methyltransf_16 150 233 7.3e-7 PFAM
Pfam:PrmA 166 240 2.1e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111490
AA Change: D77G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107116
Gene: ENSMUSG00000041396
AA Change: D77G

DomainStartEndE-ValueType
Pfam:MTS 147 232 4.5e-6 PFAM
Pfam:Methyltransf_16 149 233 3.6e-7 PFAM
Pfam:PrmA 166 238 2.7e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162949
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Derl2 A T 11: 71,014,561 F32I probably benign Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Mettl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Mettl18 APN 1 163996226 missense possibly damaging 0.83
IGL01989:Mettl18 APN 1 163996303 missense probably benign 0.00
R0190:Mettl18 UTSW 1 163996422 missense probably damaging 0.98
R0562:Mettl18 UTSW 1 163996493 missense probably benign 0.04
R2260:Mettl18 UTSW 1 163996825 missense probably benign 0.28
R4293:Mettl18 UTSW 1 163996602 missense probably damaging 1.00
R4626:Mettl18 UTSW 1 163996476 missense probably damaging 1.00
R4749:Mettl18 UTSW 1 163996785 missense probably benign 0.13
R5930:Mettl18 UTSW 1 163997177 missense probably null 0.00
R5987:Mettl18 UTSW 1 163996775 missense probably benign 0.04
R6503:Mettl18 UTSW 1 163997118 missense possibly damaging 0.94
R6687:Mettl18 UTSW 1 163996800 missense possibly damaging 0.73
R6730:Mettl18 UTSW 1 163997181 missense probably damaging 1.00
R7457:Mettl18 UTSW 1 163996761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCGCAACAGAACTAATCGAC -3'
(R):5'- AAGAGGTCAAAGGTGCATTCCCAG -3'

Sequencing Primer
(F):5'- CAACAGAACTAATCGACTGTGTG -3'
(R):5'- GGTGCATTCCCAGATTTTCAAG -3'
Posted On2013-04-24