Incidental Mutation 'R6549:Pus10'
ID521450
Institutional Source Beutler Lab
Gene Symbol Pus10
Ensembl Gene ENSMUSG00000020280
Gene Namepseudouridylate synthase 10
SynonymsCcdc139, 4933435A13Rik, 2810013G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6549 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location23665674-23732876 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 23729075 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020520] [ENSMUST00000058163] [ENSMUST00000109525]
Predicted Effect probably null
Transcript: ENSMUST00000020520
SMART Domains Protein: ENSMUSP00000020520
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000058163
SMART Domains Protein: ENSMUSP00000050395
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000109525
SMART Domains Protein: ENSMUSP00000105151
Gene: ENSMUSG00000020280

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142287
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pseudouridination, the isomerization of uridine to pseudouridine, is the most common posttranscriptional nucleotide modification found in RNA and is essential for biologic functions such as spliceosome biogenesis. Pseudouridylate synthases, such as PUS10, catalyze pseudouridination of structural RNAs, including transfer, ribosomal, and splicing RNAs. These enzymes also act as RNA chaperones, facilitating the correct folding and assembly of tRNAs (McCleverty et al., 2007 [PubMed 17900615]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm T C 9: 53,493,177 D1288G probably benign Het
Atxn7 T C 14: 14,013,087 S2P probably damaging Het
C1rl T A 6: 124,508,528 I286N probably benign Het
Ccdc54 T C 16: 50,590,025 R293G possibly damaging Het
Cndp1 A T 18: 84,636,184 I85K probably benign Het
Col25a1 A G 3: 130,182,795 T110A probably benign Het
Defb8 G T 8: 19,447,544 P17Q probably damaging Het
Dnah1 A T 14: 31,269,383 L3146Q probably damaging Het
Espn A T 4: 152,131,068 M1K probably null Het
Fam126b T C 1: 58,539,600 I264V probably benign Het
Gm9922 C A 14: 101,729,457 probably benign Het
Ldb3 A G 14: 34,541,897 M545T probably damaging Het
Olfr1076 A T 2: 86,509,382 I308L probably benign Het
Piezo1 G A 8: 122,500,263 H420Y probably benign Het
Primpol A T 8: 46,605,150 L115I probably damaging Het
Rictor C G 15: 6,796,175 A1689G probably damaging Het
Scn2a A G 2: 65,764,674 N1956D probably benign Het
Scn4a T C 11: 106,343,965 D384G probably damaging Het
Sell A G 1: 164,065,629 D138G probably damaging Het
Slc4a7 T A 14: 14,748,564 F327L probably damaging Het
Sox6 A G 7: 115,486,692 I680T possibly damaging Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Vmn1r31 A T 6: 58,472,663 N72K possibly damaging Het
Vmn2r77 A G 7: 86,800,857 I104V probably benign Het
Zfp988 G A 4: 147,331,853 C248Y probably benign Het
Other mutations in Pus10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pus10 APN 11 23707548 nonsense probably null
IGL02304:Pus10 APN 11 23712275 missense probably damaging 1.00
IGL02466:Pus10 APN 11 23725574 missense probably damaging 0.99
IGL02967:Pus10 APN 11 23718602 missense probably damaging 1.00
IGL03233:Pus10 APN 11 23712241 missense probably damaging 1.00
IGL03300:Pus10 APN 11 23731368 utr 3 prime probably benign
PIT4486001:Pus10 UTSW 11 23712326 critical splice donor site probably null
PIT4677001:Pus10 UTSW 11 23720171 missense possibly damaging 0.88
R0166:Pus10 UTSW 11 23667358 missense probably damaging 1.00
R0440:Pus10 UTSW 11 23673331 unclassified probably benign
R0519:Pus10 UTSW 11 23711201 missense probably benign 0.02
R1583:Pus10 UTSW 11 23673239 missense probably damaging 0.96
R1714:Pus10 UTSW 11 23725542 missense probably damaging 1.00
R1941:Pus10 UTSW 11 23711198 missense possibly damaging 0.60
R3687:Pus10 UTSW 11 23667334 missense probably benign
R3688:Pus10 UTSW 11 23667334 missense probably benign
R3854:Pus10 UTSW 11 23703003 critical splice donor site probably null
R4064:Pus10 UTSW 11 23728983 missense probably damaging 1.00
R4127:Pus10 UTSW 11 23718654 critical splice donor site probably null
R4276:Pus10 UTSW 11 23706895 missense probably damaging 1.00
R4655:Pus10 UTSW 11 23672707 missense probably benign 0.02
R5302:Pus10 UTSW 11 23667416 critical splice donor site probably null
R5580:Pus10 UTSW 11 23672556 missense probably benign 0.16
R6196:Pus10 UTSW 11 23672638 missense probably benign 0.15
R6722:Pus10 UTSW 11 23702975 missense possibly damaging 0.93
R6724:Pus10 UTSW 11 23729037 missense possibly damaging 0.78
X0064:Pus10 UTSW 11 23708743 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAGTCAGAGTTTAGAAATGACCTC -3'
(R):5'- GCAAATGGGATCCTGGTTTG -3'

Sequencing Primer
(F):5'- AGAGTTTAGAAATGACCTCTCTTTTG -3'
(R):5'- ATAACTCTGGTTCTAGGGGACCC -3'
Posted On2018-06-06