Incidental Mutation 'R6550:Zdhhc5'
ID521480
Institutional Source Beutler Lab
Gene Symbol Zdhhc5
Ensembl Gene ENSMUSG00000034075
Gene Namezinc finger, DHHC domain containing 5
Synonyms1110032A17Rik, Zisp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R6550 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84687970-84715180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84696341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 96 (I96V)
Ref Sequence ENSEMBL: ENSMUSP00000048198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035840]
Predicted Effect probably benign
Transcript: ENSMUST00000035840
AA Change: I96V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048198
Gene: ENSMUSG00000034075
AA Change: I96V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
Pfam:zf-DHHC 99 224 1.6e-37 PFAM
low complexity region 312 318 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 581 597 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104194
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Other mutations in Zdhhc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Zdhhc5 APN 2 84691194 missense probably damaging 0.99
IGL01795:Zdhhc5 APN 2 84690046 missense probably benign
IGL01862:Zdhhc5 APN 2 84690492 missense probably benign 0.01
PIT4449001:Zdhhc5 UTSW 2 84690227 missense probably damaging 1.00
R0270:Zdhhc5 UTSW 2 84690115 missense probably benign 0.06
R0419:Zdhhc5 UTSW 2 84691243 splice site probably null
R0543:Zdhhc5 UTSW 2 84692480 unclassified probably benign
R1171:Zdhhc5 UTSW 2 84692341 missense probably benign 0.00
R1450:Zdhhc5 UTSW 2 84702389 missense probably damaging 0.99
R1922:Zdhhc5 UTSW 2 84693427 missense probably damaging 0.99
R2229:Zdhhc5 UTSW 2 84690213 missense probably damaging 1.00
R4799:Zdhhc5 UTSW 2 84693431 missense probably damaging 0.97
R5473:Zdhhc5 UTSW 2 84690466 missense probably damaging 0.99
R5968:Zdhhc5 UTSW 2 84694375 synonymous probably null
R6299:Zdhhc5 UTSW 2 84690481 missense probably benign 0.06
R7069:Zdhhc5 UTSW 2 84715011 start gained probably benign
R7169:Zdhhc5 UTSW 2 84702331 critical splice donor site probably null
R7383:Zdhhc5 UTSW 2 84694404 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGTGCAAATACCCACAAATACATAT -3'
(R):5'- AAACTCTGGTTTGGTGCAGATA -3'

Sequencing Primer
(F):5'- TAGTTCCAGGGGATCTAATGCCAC -3'
(R):5'- TGAGTTCGATTCACAGCTCACAG -3'
Posted On2018-06-06