Incidental Mutation 'R6504:Vmn1r214'
ID523636
Institutional Source Beutler Lab
Gene Symbol Vmn1r214
Ensembl Gene ENSMUSG00000061829
Gene Namevomeronasal 1 receptor 214
SynonymsV1rh5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6504 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23030418-23037957 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 23035440 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Leucine at position 368 (*368L)
Ref Sequence ENSEMBL: ENSMUSP00000153823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074252] [ENSMUST00000227236] [ENSMUST00000227652]
Predicted Effect probably null
Transcript: ENSMUST00000074252
AA Change: *368L
SMART Domains Protein: ENSMUSP00000073868
Gene: ENSMUSG00000061829
AA Change: *368L

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:TAS2R 42 346 7.5e-9 PFAM
Pfam:V1R 75 337 5.3e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227236
AA Change: *368L
Predicted Effect probably null
Transcript: ENSMUST00000227652
AA Change: *368L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,920 T31A probably benign Het
Adam12 A T 7: 133,929,984 H507Q probably damaging Het
Ampd1 A G 3: 103,099,595 D712G possibly damaging Het
Ap4m1 T A 5: 138,178,096 D351E probably benign Het
Celsr1 T C 15: 85,978,920 T1304A probably benign Het
Dhx36 G T 3: 62,488,639 A449E probably benign Het
Dmkn A T 7: 30,776,429 K2N possibly damaging Het
Dnah10 T C 5: 124,762,782 I1217T possibly damaging Het
Dph5 A G 3: 115,926,803 probably null Het
Dysf T C 6: 84,008,925 V4A probably benign Het
Elavl4 A T 4: 110,255,382 probably null Het
Ep400 T C 5: 110,708,837 probably benign Het
Fat2 A G 11: 55,262,397 I3663T probably benign Het
Gm7233 T A 14: 43,179,937 D15E probably benign Het
Grik2 A G 10: 49,356,102 V444A probably damaging Het
Hdac4 T A 1: 91,968,455 I698F possibly damaging Het
Kank1 T C 19: 25,428,154 S1179P probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Ofcc1 A T 13: 40,097,055 L595Q probably damaging Het
Olfr1464-ps1 A C 19: 13,282,484 H191Q possibly damaging Het
Olfr958 C T 9: 39,550,278 V198M probably damaging Het
Orc1 A G 4: 108,590,717 I54V probably benign Het
Pom121l2 A G 13: 21,983,461 Q634R possibly damaging Het
Prrc2c A G 1: 162,697,795 V414A unknown Het
Ranbp3l T C 15: 8,968,462 F13L probably benign Het
Scaf11 T C 15: 96,419,460 probably null Het
Sh3d19 A G 3: 86,085,336 T224A probably benign Het
Shq1 T A 6: 100,648,247 Y217F probably benign Het
Slitrk1 A T 14: 108,911,697 H527Q probably benign Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Stxbp1 T C 2: 32,801,883 I432M possibly damaging Het
Sulf2 A G 2: 166,083,921 Y439H probably benign Het
Thoc5 T A 11: 4,924,815 C535* probably null Het
Tlr3 T C 8: 45,397,449 I280V possibly damaging Het
Ush2a A G 1: 188,911,247 S4269G probably benign Het
Wif1 C G 10: 121,035,091 Q92E probably damaging Het
Other mutations in Vmn1r214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Vmn1r214 APN 13 23035130 missense possibly damaging 0.58
IGL01759:Vmn1r214 APN 13 23034492 missense probably benign 0.00
IGL02000:Vmn1r214 APN 13 23035100 missense possibly damaging 0.90
R0115:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0468:Vmn1r214 UTSW 13 23035253 missense probably benign 0.04
R0481:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0574:Vmn1r214 UTSW 13 23034493 missense probably benign 0.19
R0686:Vmn1r214 UTSW 13 23034792 missense probably damaging 1.00
R1931:Vmn1r214 UTSW 13 23035324 missense possibly damaging 0.46
R3893:Vmn1r214 UTSW 13 23034641 missense probably benign 0.00
R4013:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4014:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4015:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4670:Vmn1r214 UTSW 13 23034971 missense probably benign 0.01
R5091:Vmn1r214 UTSW 13 23035401 missense possibly damaging 0.46
R5817:Vmn1r214 UTSW 13 23035321 missense probably damaging 0.98
R7096:Vmn1r214 UTSW 13 23035026 missense probably damaging 1.00
R7141:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7293:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7759:Vmn1r214 UTSW 13 23034461 missense not run
X0002:Vmn1r214 UTSW 13 23034801 missense probably damaging 0.98
Z1176:Vmn1r214 UTSW 13 23034495 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTCGAGAACTTTTGACCCTTGG -3'
(R):5'- GTAGTACTGCCAGTTTTACAAATCC -3'

Sequencing Primer
(F):5'- TGACCCTTGGTTATGCAACG -3'
(R):5'- TAGCTTGAATATGCCCCAGG -3'
Posted On2018-06-22