Incidental Mutation 'R6504:Stxbp1'
ID523587
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Namesyntaxin binding protein 1
SynonymsRb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R6504 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32787602-32847245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32801883 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 432 (I432M)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050000
AA Change: I432M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: I432M

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000077458
AA Change: I432M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: I432M

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113222
SMART Domains Protein: ENSMUSP00000108848
Gene: ENSMUSG00000026797

DomainStartEndE-ValueType
Pfam:Sec1 1 419 1.7e-106 PFAM
Meta Mutation Damage Score 0.2176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,920 T31A probably benign Het
Adam12 A T 7: 133,929,984 H507Q probably damaging Het
Ampd1 A G 3: 103,099,595 D712G possibly damaging Het
Ap4m1 T A 5: 138,178,096 D351E probably benign Het
Celsr1 T C 15: 85,978,920 T1304A probably benign Het
Dhx36 G T 3: 62,488,639 A449E probably benign Het
Dmkn A T 7: 30,776,429 K2N possibly damaging Het
Dnah10 T C 5: 124,762,782 I1217T possibly damaging Het
Dph5 A G 3: 115,926,803 probably null Het
Dysf T C 6: 84,008,925 V4A probably benign Het
Elavl4 A T 4: 110,255,382 probably null Het
Ep400 T C 5: 110,708,837 probably benign Het
Fat2 A G 11: 55,262,397 I3663T probably benign Het
Gm7233 T A 14: 43,179,937 D15E probably benign Het
Grik2 A G 10: 49,356,102 V444A probably damaging Het
Hdac4 T A 1: 91,968,455 I698F possibly damaging Het
Kank1 T C 19: 25,428,154 S1179P probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Ofcc1 A T 13: 40,097,055 L595Q probably damaging Het
Olfr1464-ps1 A C 19: 13,282,484 H191Q possibly damaging Het
Olfr958 C T 9: 39,550,278 V198M probably damaging Het
Orc1 A G 4: 108,590,717 I54V probably benign Het
Pom121l2 A G 13: 21,983,461 Q634R possibly damaging Het
Prrc2c A G 1: 162,697,795 V414A unknown Het
Ranbp3l T C 15: 8,968,462 F13L probably benign Het
Scaf11 T C 15: 96,419,460 probably null Het
Sh3d19 A G 3: 86,085,336 T224A probably benign Het
Shq1 T A 6: 100,648,247 Y217F probably benign Het
Slitrk1 A T 14: 108,911,697 H527Q probably benign Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Sulf2 A G 2: 166,083,921 Y439H probably benign Het
Thoc5 T A 11: 4,924,815 C535* probably null Het
Tlr3 T C 8: 45,397,449 I280V possibly damaging Het
Ush2a A G 1: 188,911,247 S4269G probably benign Het
Vmn1r214 A T 13: 23,035,440 *368L probably null Het
Wif1 C G 10: 121,035,091 Q92E probably damaging Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32812064 missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32819901 missense probably damaging 0.98
volume UTSW 2 32801893 missense probably damaging 0.99
volume2 UTSW 2 32801883 missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32823538 missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32801870 missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32823542 missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32802905 splice site probably benign
R0565:Stxbp1 UTSW 2 32819848 missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32800695 splice site probably benign
R1022:Stxbp1 UTSW 2 32814967 unclassified probably null
R1024:Stxbp1 UTSW 2 32814967 unclassified probably null
R1295:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32800617 missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32806719 critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32798189 missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32794674 missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32796018 missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32794609 missense probably damaging 0.98
R6770:Stxbp1 UTSW 2 32819889 missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32801893 missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32815014 missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32798168 missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32818505 missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32801820 missense probably benign 0.00
RF010:Stxbp1 UTSW 2 32821915 missense probably benign 0.06
X0060:Stxbp1 UTSW 2 32802768 missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32802754 missense probably null 1.00
Z1177:Stxbp1 UTSW 2 32809128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTGATGTTGTATACCGCTGTATC -3'
(R):5'- TTTCTCATCTCGTAGGCAGGGAC -3'

Sequencing Primer
(F):5'- ACCGCTGTATCATAATGGGC -3'
(R):5'- TGCCAGGTGGACGGAAC -3'
Posted On2018-06-22