Incidental Mutation 'R0574:Vmn1r214'
ID46585
Institutional Source Beutler Lab
Gene Symbol Vmn1r214
Ensembl Gene ENSMUSG00000061829
Gene Namevomeronasal 1 receptor 214
SynonymsV1rh5
MMRRC Submission 038764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0574 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23030418-23037957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23034493 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 52 (I52M)
Ref Sequence ENSEMBL: ENSMUSP00000153823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074252] [ENSMUST00000227236] [ENSMUST00000227652]
Predicted Effect probably benign
Transcript: ENSMUST00000074252
AA Change: I52M

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073868
Gene: ENSMUSG00000061829
AA Change: I52M

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:TAS2R 42 346 7.5e-9 PFAM
Pfam:V1R 75 337 5.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227236
AA Change: I52M

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227652
AA Change: I52M

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700099C18Rik T C 17: 94,761,491 noncoding transcript Het
Abca14 A G 7: 120,224,497 I416V probably damaging Het
Actrt3 T C 3: 30,599,680 E57G probably benign Het
Adamts5 A G 16: 85,899,484 S262P probably damaging Het
Aldh1a2 T C 9: 71,281,708 probably null Het
Arhgap29 A G 3: 122,007,625 I670V probably benign Het
Bptf T C 11: 107,076,527 D1009G probably damaging Het
Ddr2 G T 1: 169,981,963 probably benign Het
Ift140 T A 17: 25,051,760 probably null Het
Itga1 A C 13: 114,966,561 S1111R probably damaging Het
Klk1b27 T A 7: 44,056,101 L199Q probably damaging Het
Lhx3 T C 2: 26,201,311 S329G probably benign Het
Man2b1 T G 8: 85,096,776 M913R probably benign Het
Mmp15 G A 8: 95,365,401 A80T possibly damaging Het
Mpo A T 11: 87,796,076 Y177F probably damaging Het
Mynn T C 3: 30,616,739 S587P probably benign Het
Nfkbib C T 7: 28,761,788 V145I probably benign Het
Olfr421-ps1 T C 1: 174,151,566 F17L probably benign Het
Olfr727 A T 14: 50,126,682 Y35F probably damaging Het
Olfr98 G T 17: 37,262,881 S261Y probably damaging Het
Pole2 G A 12: 69,211,457 probably benign Het
Ppargc1b C T 18: 61,302,739 G906D probably benign Het
Prl8a2 T A 13: 27,348,900 C32S probably damaging Het
Rhno1 A T 6: 128,358,150 probably null Het
Rprd2 T C 3: 95,774,357 E408G possibly damaging Het
Ryr2 T A 13: 11,731,669 H1999L probably benign Het
Shprh T C 10: 11,163,077 probably benign Het
Snx3 T A 10: 42,502,387 N19K probably benign Het
Stx8 C T 11: 67,973,252 T46M probably damaging Het
Tbc1d17 A G 7: 44,843,123 probably benign Het
Ush1c A G 7: 46,196,804 S855P possibly damaging Het
Usp54 A G 14: 20,556,254 V1338A probably benign Het
Other mutations in Vmn1r214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Vmn1r214 APN 13 23035130 missense possibly damaging 0.58
IGL01759:Vmn1r214 APN 13 23034492 missense probably benign 0.00
IGL02000:Vmn1r214 APN 13 23035100 missense possibly damaging 0.90
R0115:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0468:Vmn1r214 UTSW 13 23035253 missense probably benign 0.04
R0481:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0686:Vmn1r214 UTSW 13 23034792 missense probably damaging 1.00
R1931:Vmn1r214 UTSW 13 23035324 missense possibly damaging 0.46
R3893:Vmn1r214 UTSW 13 23034641 missense probably benign 0.00
R4013:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4014:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4015:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4670:Vmn1r214 UTSW 13 23034971 missense probably benign 0.01
R5091:Vmn1r214 UTSW 13 23035401 missense possibly damaging 0.46
R5817:Vmn1r214 UTSW 13 23035321 missense probably damaging 0.98
R6504:Vmn1r214 UTSW 13 23035440 makesense probably null
R7096:Vmn1r214 UTSW 13 23035026 missense probably damaging 1.00
R7141:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7293:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7759:Vmn1r214 UTSW 13 23034461 missense not run
X0002:Vmn1r214 UTSW 13 23034801 missense probably damaging 0.98
Z1176:Vmn1r214 UTSW 13 23034495 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AACATGCGTCTACCACTGCCTC -3'
(R):5'- ATGGGCCACCCTCTCCATGTAAAC -3'

Sequencing Primer
(F):5'- TGCCTCTTGAACACAAGAAAATG -3'
(R):5'- TCCATGTAAACAATGATCTTACAGCC -3'
Posted On2013-06-11