Incidental Mutation 'R6628:Olfr196'
ID524938
Institutional Source Beutler Lab
Gene Symbol Olfr196
Ensembl Gene ENSMUSG00000096695
Gene Nameolfactory receptor 196
SynonymsMOR183-1, GA_x54KRFPKG5P-55389051-55388122
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6628 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59166647-59170454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59167981 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 54 (H54R)
Ref Sequence ENSEMBL: ENSMUSP00000145684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077027] [ENSMUST00000205471]
Predicted Effect probably benign
Transcript: ENSMUST00000077027
AA Change: H54R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076285
Gene: ENSMUSG00000096695
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-48 PFAM
Pfam:7tm_1 41 290 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205471
AA Change: H54R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,795,825 M565R probably benign Het
Cd4 A G 6: 124,879,468 L20P unknown Het
Chrm2 G T 6: 36,523,357 V50F probably damaging Het
Clasp2 A G 9: 113,896,720 T828A probably damaging Het
Clec4a4 A G 6: 123,012,804 K135E probably benign Het
Clmn T C 12: 104,773,786 R961G probably damaging Het
Cyp2s1 T C 7: 25,815,041 K64E probably benign Het
Dagla T C 19: 10,263,227 D213G probably damaging Het
Dsp A T 13: 38,167,622 E139V possibly damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Gm7030 T C 17: 36,129,054 S63G possibly damaging Het
Gtf3c1 A T 7: 125,668,074 D928E probably benign Het
Gulo T C 14: 66,004,170 K80E probably benign Het
Kdm5d A G Y: 900,525 Y190C probably damaging Homo
Kif27 A T 13: 58,354,797 H22Q probably damaging Het
Kmt2c T C 5: 25,298,928 D383G probably benign Het
Lmtk2 A G 5: 144,174,685 E741G probably benign Het
Mphosph9 G T 5: 124,298,762 N506K probably damaging Het
Myo16 T C 8: 10,570,638 S1674P probably damaging Het
Olfr1062 T G 2: 86,423,017 N220H probably benign Het
Pdcd10 A G 3: 75,521,071 V82A probably damaging Het
Ptpn11 G T 5: 121,134,829 probably null Het
Pxdn T C 12: 29,999,918 L475P probably damaging Het
Senp6 A G 9: 80,132,954 D781G probably damaging Het
Tbc1d5 T C 17: 50,736,208 T751A probably benign Het
Tbx18 A T 9: 87,715,535 Y315* probably null Het
Wrap53 T C 11: 69,562,144 K446E probably benign Het
Wwp1 T C 4: 19,661,963 probably null Het
Other mutations in Olfr196
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Olfr196 APN 16 59167528 nonsense probably null
PIT4495001:Olfr196 UTSW 16 59167974 missense possibly damaging 0.48
R0312:Olfr196 UTSW 16 59167839 missense probably benign 0.00
R0345:Olfr196 UTSW 16 59167906 missense possibly damaging 0.90
R0644:Olfr196 UTSW 16 59167616 missense probably damaging 1.00
R0679:Olfr196 UTSW 16 59167616 missense probably damaging 1.00
R1709:Olfr196 UTSW 16 59167901 missense probably benign 0.03
R1818:Olfr196 UTSW 16 59167880 missense probably benign 0.00
R2090:Olfr196 UTSW 16 59168140 start codon destroyed probably null 0.99
R5327:Olfr196 UTSW 16 59167620 missense possibly damaging 0.96
R5945:Olfr196 UTSW 16 59168119 missense probably benign 0.42
R6093:Olfr196 UTSW 16 59167967 missense probably damaging 1.00
R6268:Olfr196 UTSW 16 59167293 synonymous probably null
R6487:Olfr196 UTSW 16 59168173 splice site probably null
R6679:Olfr196 UTSW 16 59167846 missense probably benign
R7642:Olfr196 UTSW 16 59167717 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGATCATAGGCCATTGCTGC -3'
(R):5'- CACTGCGTTTCATTTCAGGG -3'

Sequencing Primer
(F):5'- CATAGGCCATTGCTGCCAAGAG -3'
(R):5'- GCGTTTCATTTCAGGGACACC -3'
Posted On2018-06-22