Incidental Mutation 'R6924:Ppp1r17'
ID539787
Institutional Source Beutler Lab
Gene Symbol Ppp1r17
Ensembl Gene ENSMUSG00000002930
Gene Nameprotein phosphatase 1, regulatory subunit 17
SynonymsGsbs, G-substrate
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location56017497-56032689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56026022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 32 (D32E)
Ref Sequence ENSEMBL: ENSMUSP00000059708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052827]
Predicted Effect probably damaging
Transcript: ENSMUST00000052827
AA Change: D32E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059708
Gene: ENSMUSG00000002930
AA Change: D32E

DomainStartEndE-ValueType
internal_repeat_1 34 84 1.12e-11 PROSPERO
internal_repeat_1 85 135 1.12e-11 PROSPERO
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found primarily in cerebellar Purkinje cells, where it functions as a protein phosphatase inhibitor. The encoded protein is a substrate for cGMP-dependent protein kinase. An allele of this gene was discovered that increases susceptibility to hypercholesterolemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Atg7 T C 6: 114,709,211 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Cyp2d9 C G 15: 82,455,212 R272G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Gpr161 G T 1: 165,321,619 R519L possibly damaging Het
Grin2a A G 16: 9,663,228 V535A possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr726 A G 14: 50,083,850 I277T possibly damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Zfp804b C T 5: 6,769,902 V1018I probably benign Het
Other mutations in Ppp1r17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Ppp1r17 APN 6 56026138 missense probably damaging 1.00
IGL02534:Ppp1r17 APN 6 56026460 nonsense probably null
R1846:Ppp1r17 UTSW 6 56022427 missense possibly damaging 0.94
R4859:Ppp1r17 UTSW 6 56026464 missense probably damaging 1.00
R5698:Ppp1r17 UTSW 6 56026544 missense probably damaging 1.00
R7752:Ppp1r17 UTSW 6 56022456 missense probably damaging 1.00
R8123:Ppp1r17 UTSW 6 56022458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCAACGAGGAACAGTTAG -3'
(R):5'- TGCCATTACAGCCACAGAGAG -3'

Sequencing Primer
(F):5'- GTTAGGACCATCTAGAACTCCAGTC -3'
(R):5'- GAGAGCAACATGTCCCGC -3'
Posted On2018-11-06