Incidental Mutation 'R7815:Galk2'
ID 601444
Institutional Source Beutler Lab
Gene Symbol Galk2
Ensembl Gene ENSMUSG00000027207
Gene Name galactokinase 2
Synonyms 2810017M24Rik, Gk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7815 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 125859109-125984299 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 125975401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 370 (S370N)
Ref Sequence ENSEMBL: ENSMUSP00000092186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028636] [ENSMUST00000094604]
AlphaFold Q68FH4
Predicted Effect probably damaging
Transcript: ENSMUST00000028636
AA Change: S359N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028636
Gene: ENSMUSG00000027207
AA Change: S359N

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 13 62 3.8e-26 PFAM
Pfam:GHMP_kinases_N 120 187 1e-15 PFAM
Pfam:GHMP_kinases_C 333 419 6.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094604
AA Change: S370N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092186
Gene: ENSMUSG00000027207
AA Change: S370N

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 24 73 3.2e-25 PFAM
Pfam:GHMP_kinases_N 131 198 4.8e-15 PFAM
Pfam:GHMP_kinases_C 344 430 3.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,830,427 D1285G probably benign Het
Abcc9 A G 6: 142,652,605 V669A probably damaging Het
Ajap1 C A 4: 153,432,831 G18C probably damaging Het
Alms1 G T 6: 85,615,358 M397I probably benign Het
Ampd2 A T 3: 108,074,931 M794K probably benign Het
Ankrd35 A T 3: 96,684,801 Q801L probably damaging Het
Casz1 A T 4: 148,929,305 I109F possibly damaging Het
Ces5a G A 8: 93,520,995 S297F possibly damaging Het
Col7a1 A G 9: 108,969,565 D1762G probably damaging Het
Dsp A T 13: 38,191,470 Y1077F probably benign Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erbb4 A G 1: 68,042,726 Y1050H probably damaging Het
Fpgt A T 3: 155,086,652 S579R probably benign Het
Gabra4 T A 5: 71,657,809 M1L possibly damaging Het
Gpr155 T A 2: 73,362,560 T516S probably benign Het
Homez T C 14: 54,858,218 N11S probably benign Het
Hspg2 G A 4: 137,512,464 G494D probably damaging Het
Htr3b C T 9: 48,945,533 R215Q probably benign Het
Igfbp4 A G 11: 99,041,828 E111G probably benign Het
Igkv8-19 T C 6: 70,341,436 T5A probably benign Het
Insrr A G 3: 87,808,695 K566E probably damaging Het
Iqsec3 A G 6: 121,473,358 V69A probably benign Het
Kdm5d T C Y: 940,702 V1071A probably damaging Het
Kif28 A G 1: 179,735,983 C143R probably damaging Het
Kpna6 T C 4: 129,657,797 M65V probably benign Het
L3mbtl3 T C 10: 26,280,378 S669G unknown Het
Man1a2 A T 3: 100,656,179 I50N probably damaging Het
Map3k11 A T 19: 5,695,639 M356L possibly damaging Het
Meioc A T 11: 102,675,588 N677Y probably damaging Het
Myom3 A T 4: 135,801,363 K1108M possibly damaging Het
Nav1 C T 1: 135,584,639 E228K possibly damaging Het
Ncapd3 G A 9: 27,063,440 W736* probably null Het
Nfkb1 T C 3: 135,603,791 D514G probably damaging Het
Nnt T A 13: 119,357,575 T657S possibly damaging Het
Olfr66 A G 7: 103,881,785 S153P probably benign Het
Olfr729 A G 14: 50,148,796 F26S probably benign Het
Oser1 A T 2: 163,411,416 S58T possibly damaging Het
Pcdha5 T A 18: 36,961,503 I355N possibly damaging Het
Pllp C G 8: 94,676,176 G99A probably damaging Het
Pram1 A G 17: 33,642,132 N509S probably benign Het
Prkd1 A C 12: 50,425,517 N204K probably damaging Het
Prss23 G A 7: 89,510,045 P272L probably damaging Het
Pxdn T C 12: 30,005,825 F1057L probably damaging Het
Rapgef5 T A 12: 117,755,967 S777R probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rfx3 A T 19: 27,826,048 M265K probably benign Het
S100a7a C A 3: 90,657,812 H105N probably benign Het
Serpinb3b T C 1: 107,156,895 D132G probably damaging Het
Sp7 T A 15: 102,366,387 probably benign Het
Tacstd2 A G 6: 67,535,156 F184S possibly damaging Het
Trdc C A 14: 54,143,802 probably benign Het
Trpa1 T A 1: 14,904,262 H232L probably benign Het
Trpc3 G T 3: 36,655,145 T394K probably benign Het
Tuba3b G A 6: 145,621,121 V363I possibly damaging Het
Tubb2a C A 13: 34,074,979 R276L probably benign Het
Ubap2l A T 3: 90,043,764 L72* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Wdr26 A G 1: 181,209,073 V166A probably benign Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Xirp2 G A 2: 67,509,412 G666R probably damaging Het
Zfp131 T C 13: 119,775,980 K247E probably damaging Het
Other mutations in Galk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Galk2 APN 2 125896765 missense probably benign 0.29
IGL01663:Galk2 APN 2 125983179 missense probably benign
IGL01669:Galk2 APN 2 125887887 missense probably damaging 1.00
IGL01831:Galk2 APN 2 125975357 missense probably benign 0.01
IGL02055:Galk2 APN 2 125931404 missense probably benign 0.01
IGL02298:Galk2 APN 2 125859370 missense probably benign 0.00
IGL03093:Galk2 APN 2 125929643 missense probably damaging 1.00
R0305:Galk2 UTSW 2 125887888 missense probably damaging 1.00
R1713:Galk2 UTSW 2 125931290 missense probably benign 0.00
R1870:Galk2 UTSW 2 125975263 missense probably benign
R2327:Galk2 UTSW 2 125975395 missense probably damaging 1.00
R2354:Galk2 UTSW 2 125931273 missense probably benign 0.06
R3962:Galk2 UTSW 2 125893373 missense probably benign 0.13
R4870:Galk2 UTSW 2 125929637 nonsense probably null
R5034:Galk2 UTSW 2 125929575 missense probably benign 0.00
R5427:Galk2 UTSW 2 125946821 missense probably benign 0.01
R5619:Galk2 UTSW 2 125975397 nonsense probably null
R6145:Galk2 UTSW 2 125946842 missense possibly damaging 0.90
R6173:Galk2 UTSW 2 125859217 start gained probably benign
R6287:Galk2 UTSW 2 125870348 intron probably benign
R7174:Galk2 UTSW 2 125896701 missense probably damaging 1.00
R7453:Galk2 UTSW 2 125887861 missense possibly damaging 0.51
R7480:Galk2 UTSW 2 125946925 missense probably benign
R7519:Galk2 UTSW 2 125983252 missense possibly damaging 0.60
R8094:Galk2 UTSW 2 125931269 missense probably damaging 1.00
R8323:Galk2 UTSW 2 125866378 missense probably benign
R8478:Galk2 UTSW 2 125929585 nonsense probably null
R9292:Galk2 UTSW 2 125975298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACTGGATAGTCTTGTAACCC -3'
(R):5'- AACATGGGAGCTCTACATCAGG -3'

Sequencing Primer
(F):5'- GGATAGTCTTGTAACCCTTTCTTG -3'
(R):5'- TGGGAGCTCTACATCAGGAGGAC -3'
Posted On 2019-12-03