Incidental Mutation 'R8345:Fam8a1'
ID645195
Institutional Source Beutler Lab
Gene Symbol Fam8a1
Ensembl Gene ENSMUSG00000069237
Gene Namefamily with sequence similarity 8, member A1
SynonymsC78339
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8345 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location46669522-46678056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46673578 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 275 (I275K)
Ref Sequence ENSEMBL: ENSMUSP00000097144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099547]
Predicted Effect probably damaging
Transcript: ENSMUST00000099547
AA Change: I275K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097144
Gene: ENSMUSG00000069237
AA Change: I275K

DomainStartEndE-ValueType
low complexity region 31 56 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 168 190 N/A INTRINSIC
Pfam:RDD 229 389 2.9e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,325,630 N145Y probably damaging Het
9530053A07Rik G A 7: 28,155,360 V1804M probably damaging Het
Acsf3 T C 8: 122,781,545 V260A probably benign Het
Adgrv1 T C 13: 81,103,386 D6204G probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Aspm T G 1: 139,464,273 Y787* probably null Het
Atp8b5 A C 4: 43,291,714 D29A probably benign Het
Bdh2 A T 3: 135,295,252 I128F probably damaging Het
Bmper T A 9: 23,224,830 M69K probably benign Het
Ccdc7a C T 8: 128,798,764 M1415I probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cdc23 G A 18: 34,634,097 T564I probably benign Het
Cemip T A 7: 83,942,165 probably null Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpsf1 T A 15: 76,601,490 T435S probably benign Het
Dennd5a T C 7: 109,905,270 T879A possibly damaging Het
Diaph3 G A 14: 86,829,093 Q955* probably null Het
Disp2 G A 2: 118,810,803 V298M unknown Het
Dnah1 C A 14: 31,264,594 D3671Y probably damaging Het
Dnmt3a T C 12: 3,835,234 S13P unknown Het
Eci3 G A 13: 34,948,181 T228I probably damaging Het
Ecm2 T C 13: 49,520,800 L232P probably benign Het
Ednra G A 8: 77,689,184 R145C probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Fat3 C A 9: 15,999,274 V1811L probably benign Het
Fbn2 C T 18: 58,058,431 C1540Y probably damaging Het
Ffar3 A G 7: 30,855,364 L177P probably damaging Het
Fmnl1 A G 11: 103,186,614 T267A possibly damaging Het
Fsip1 T C 2: 118,240,471 E246G probably damaging Het
Gemin4 A G 11: 76,210,779 L1052P probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Grm5 A T 7: 88,074,538 I679F probably damaging Het
Hapln1 A T 13: 89,584,783 D21V probably benign Het
Jak2 T C 19: 29,284,870 S364P probably damaging Het
Kansl3 A G 1: 36,348,816 probably null Het
Kntc1 T C 5: 123,786,930 L1102S probably benign Het
Mbd3l2 A G 9: 18,444,483 I35V probably benign Het
Mdfic G T 6: 15,799,654 C260F probably damaging Het
Mroh2b T C 15: 4,944,326 S1109P probably benign Het
Myocd A T 11: 65,187,132 C612* probably null Het
Olfr1053 A T 2: 86,315,107 Y60N probably damaging Het
Olfr1189 A G 2: 88,592,091 M96V probably benign Het
Olfr1293-ps T A 2: 111,527,519 C86* probably null Het
Olfr142 A T 2: 90,252,217 M257K possibly damaging Het
Olfr153 A T 2: 87,532,347 T105S probably benign Het
Olfr652 T A 7: 104,564,224 M1K probably null Het
Pard3 C T 8: 127,324,068 R204W probably damaging Het
Per1 T A 11: 69,107,556 N1031K possibly damaging Het
Plekhh3 A G 11: 101,164,279 S583P unknown Het
Pramef8 C T 4: 143,416,868 T68I probably benign Het
Prex2 T A 1: 11,199,894 C1268S possibly damaging Het
Prpf6 T C 2: 181,650,158 I756T probably benign Het
Pum2 T C 12: 8,709,454 V98A probably damaging Het
Rad50 A T 11: 53,684,141 S652T probably benign Het
Rfng G T 11: 120,784,075 P30T unknown Het
Rfx7 T C 9: 72,617,691 I721T probably benign Het
Rpf1 G T 3: 146,507,676 T240K probably benign Het
Ryr3 T C 2: 112,652,925 N4189S probably benign Het
Samd15 G C 12: 87,201,438 R299T probably benign Het
Scn3a A G 2: 65,498,991 M765T possibly damaging Het
Scn9a G A 2: 66,494,622 S1396L probably damaging Het
Sec24a C T 11: 51,743,778 R107Q probably benign Het
Sema4b T A 7: 80,220,819 V505E probably damaging Het
Siglec1 T A 2: 131,078,578 T769S possibly damaging Het
Sit1 T C 4: 43,483,168 E69G possibly damaging Het
Slc12a8 C A 16: 33,550,951 D121E probably benign Het
Slc30a10 A T 1: 185,455,467 Q135L probably benign Het
Suox A G 10: 128,671,331 V276A probably benign Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tmed5 A G 5: 108,125,957 W139R probably damaging Het
Tnks1bp1 C T 2: 85,062,882 T389I possibly damaging Het
Vmn1r65 A T 7: 6,008,257 I326K probably benign Het
Vmn2r43 A G 7: 8,253,602 S421P possibly damaging Het
Vmn2r57 A T 7: 41,427,544 N399K possibly damaging Het
Vmn2r90 T A 17: 17,712,865 L229* probably null Het
Vwf A T 6: 125,679,302 D2610V Het
Zfp646 C T 7: 127,883,910 S1753L probably benign Het
Zfy2 C A Y: 2,107,096 V513F possibly damaging Het
Zranb2 A T 3: 157,546,094 I317F unknown Het
Other mutations in Fam8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Fam8a1 APN 13 46673671 critical splice donor site probably null
IGL02067:Fam8a1 APN 13 46669848 missense possibly damaging 0.49
IGL02670:Fam8a1 APN 13 46673604 missense possibly damaging 0.83
R0626:Fam8a1 UTSW 13 46671223 missense probably damaging 1.00
R4594:Fam8a1 UTSW 13 46671266 missense probably damaging 1.00
R5155:Fam8a1 UTSW 13 46673562 missense probably benign 0.34
R5652:Fam8a1 UTSW 13 46674338 missense probably damaging 1.00
R5654:Fam8a1 UTSW 13 46674338 missense probably damaging 1.00
R5655:Fam8a1 UTSW 13 46674338 missense probably damaging 1.00
R6192:Fam8a1 UTSW 13 46669623 missense probably damaging 1.00
R7637:Fam8a1 UTSW 13 46671247 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACAATCACAACCATGCTTTTG -3'
(R):5'- AGCACATGCCATCTCGGAAC -3'

Sequencing Primer
(F):5'- GCACTTTGTTGGTGAGAAC -3'
(R):5'- CTCCAGTTAGCAGCTTAC -3'
Posted On2020-09-02