Incidental Mutation 'R7987:Ecsit'
ID651542
Institutional Source Beutler Lab
Gene Symbol Ecsit
Ensembl Gene ENSMUSG00000066839
Gene NameECSIT signalling integrator
SynonymsSitpec
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7987 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location22072246-22085438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22073484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 296 (R296L)
Ref Sequence ENSEMBL: ENSMUSP00000096537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043922] [ENSMUST00000098937] [ENSMUST00000177967] [ENSMUST00000179422] [ENSMUST00000179605] [ENSMUST00000180180]
Predicted Effect probably benign
Transcript: ENSMUST00000043922
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098937
AA Change: R296L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096537
Gene: ENSMUSG00000066839
AA Change: R296L

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177967
SMART Domains Protein: ENSMUSP00000135936
Gene: ENSMUSG00000066839

DomainStartEndE-ValueType
Pfam:ECSIT 1 197 4.4e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179422
AA Change: R296L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137424
Gene: ENSMUSG00000066839
AA Change: R296L

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179605
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180180
AA Change: R296L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136247
Gene: ENSMUSG00000066839
AA Change: R296L

DomainStartEndE-ValueType
Pfam:ECSIT 44 266 6.2e-108 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Meta Mutation Damage Score 0.8973 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die around the stage of gastrulation showing abnormal epiblast patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Atp6v0a2 G A 5: 124,719,986 G810D probably damaging Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Cacna1i G A 15: 80,320,352 probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hsp90ab1 A C 17: 45,571,606 I54S probably damaging Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Mst1r A T 9: 107,912,798 probably null Het
Mtus2 G T 5: 148,232,026 probably null Het
Myo3b A G 2: 70,330,933 T1174A probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Oacyl A G 18: 65,698,391 E33G probably benign Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Slc10a7 T A 8: 78,697,214 F202I probably benign Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Vmn2r50 T C 7: 10,038,089 T562A probably benign Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Ecsit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Ecsit APN 9 22073014 missense probably benign 0.00
IGL02114:Ecsit APN 9 22078144 splice site probably benign
IGL02457:Ecsit APN 9 22078204 missense probably damaging 0.98
IGL03365:Ecsit APN 9 22076526 missense probably damaging 0.99
charade UTSW 9 22073484 missense probably damaging 1.00
hoax UTSW 9 22076500 missense probably benign 0.00
PIT4458001:Ecsit UTSW 9 22076284 missense probably damaging 1.00
R0051:Ecsit UTSW 9 22076288 missense probably benign 0.01
R0051:Ecsit UTSW 9 22076288 missense probably benign 0.01
R0684:Ecsit UTSW 9 22076500 missense probably benign 0.00
R1703:Ecsit UTSW 9 22074811 missense probably damaging 1.00
R1903:Ecsit UTSW 9 22076519 missense possibly damaging 0.74
R1916:Ecsit UTSW 9 22072521 missense probably benign
R2280:Ecsit UTSW 9 22076540 missense possibly damaging 0.73
R2281:Ecsit UTSW 9 22076540 missense possibly damaging 0.73
R5983:Ecsit UTSW 9 22078147 critical splice donor site probably null
R6157:Ecsit UTSW 9 22074691 missense probably damaging 1.00
R6474:Ecsit UTSW 9 22074685 missense possibly damaging 0.91
R7977:Ecsit UTSW 9 22073484 missense probably damaging 1.00
R8050:Ecsit UTSW 9 22076296 missense probably benign 0.03
X0024:Ecsit UTSW 9 22074815 critical splice acceptor site probably null
X0025:Ecsit UTSW 9 22072404 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTAAACATTTATGCATACCCC -3'
(R):5'- CACATTGTAGGTAAGGCCCCAG -3'

Sequencing Primer
(F):5'- GCATACCCCTGTGTAATTCAGAG -3'
(R):5'- AGCCTATCCCAGTTTCTGCTG -3'
Posted On2020-09-15