Mutagenetix > Incidental Mutation

Incidental Mutation 'R7987:Mst1r'

656415

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R7987 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

splice site (66 bp from exon)

DNA Base Change (assembly)

A to T at 107912798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably null
Transcript: ENSMUST00000035203

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	G	T	2: 32,574,305	Q161K	unknown	Het
Acsl5	T	C	19: 55,277,973		probably null	Het
Adgre1	T	A	17: 57,447,987	I695N	possibly damaging	Het
Ank2	T	C	3: 126,945,707	D2176G	unknown	Het
Atp6v0a2	G	A	5: 124,719,986	G810D	probably damaging	Het
Bod1l	A	C	5: 41,795,070	N2868K	probably damaging	Het
Brd7	T	C	8: 88,334,141	T526A	probably benign	Het
C9	T	A	15: 6,467,462	Y213*	probably null	Het
Cacna1i	G	A	15: 80,320,352		probably null	Het
Card6	T	A	15: 5,100,525	N463I	probably damaging	Het
Ccdc81	T	C	7: 89,876,111	Y485C	probably damaging	Het
Celsr1	A	G	15: 86,032,993	F260L	probably damaging	Het
Dnah8	A	G	17: 30,744,524	D2304G	probably damaging	Het
Dnase1	A	G	16: 4,037,970	D55G	probably damaging	Het
Ecsit	C	A	9: 22,073,484	R296L	probably damaging	Het
Entpd8	A	G	2: 25,084,766	D403G	probably damaging	Het
Epha2	C	A	4: 141,308,480	Q76K	probably damaging	Het
Exoc1	T	A	5: 76,543,585	V252E	probably damaging	Het
Fmnl3	T	A	15: 99,328,098	H225L	possibly damaging	Het
Gm4565	A	C	7: 22,583,387	M2R	probably benign	Het
Gpr146	G	T	5: 139,392,685	A81S	possibly damaging	Het
Heg1	C	A	16: 33,720,730	S419*	probably null	Het
Hps5	A	C	7: 46,769,051	I865S	probably benign	Het
Hsp90ab1	A	C	17: 45,571,606	I54S	probably damaging	Het
Hyal4	T	G	6: 24,763,866	M342R	probably damaging	Het
Itgal	A	G	7: 127,328,298	T987A	possibly damaging	Het
Kat6b	A	G	14: 21,669,863	T1428A	probably benign	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Lmtk2	A	G	5: 144,175,141	D893G	probably benign	Het
Mtus2	G	T	5: 148,232,026		probably null	Het
Myo3b	A	G	2: 70,330,933	T1174A	probably benign	Het
Nsun5	G	A	5: 135,375,680	R424H	probably damaging	Het
Oacyl	A	G	18: 65,698,391	E33G	probably benign	Het
Olfr77	T	C	9: 19,920,314	F35S	possibly damaging	Het
Olfr798	T	C	10: 129,625,969	I31V	probably benign	Het
Palm	C	T	10: 79,793,705		probably benign	Het
Papln	A	G	12: 83,775,382	E337G	probably damaging	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Setd1b	A	G	5: 123,147,680	D263G	unknown	Het
Slc10a7	T	A	8: 78,697,214	F202I	probably benign	Het
Smpd3	T	C	8: 106,259,894	I455V	probably benign	Het
Snip1	G	T	4: 125,066,939	G63W	probably damaging	Het
Sorl1	T	A	9: 41,977,561	Y1981F	probably damaging	Het
Tagln2	A	G	1: 172,505,253	T36A	probably benign	Het
Tnxb	T	C	17: 34,710,220	S2746P	possibly damaging	Het
Tob2	G	A	15: 81,851,480	P96L	probably damaging	Het
Triobp	T	A	15: 79,001,544	Y1816N	probably damaging	Het
Trpc3	A	G	3: 36,644,169	I647T	probably benign	Het
Ttn	A	G	2: 76,891,561	S6600P	unknown	Het
Vmn1r200	A	T	13: 22,395,855	Y276F	possibly damaging	Het
Vmn1r230	T	C	17: 20,846,897	I116T	probably benign	Het
Vmn1r26	A	T	6: 58,008,279	Y308*	probably null	Het
Vmn2r16	C	T	5: 109,340,149	T296I	probably damaging	Het
Vmn2r50	T	C	7: 10,038,089	T562A	probably benign	Het
Wdfy2	A	G	14: 62,951,931	D283G	possibly damaging	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TACGAGGCTCACCCTTTGTG -3'
(R):5'- ACGAGGCTTCTCTGAACCTC -3'

Sequencing Primer
(F):5'- GTGGCTCCAACTTCTACCTG -3'
(R):5'- TGAACCTCAGAGGAGCATCTC -3'

Posted On

2020-11-09