Incidental Mutation 'R8838:Sdc2'
ID 674290
Institutional Source Beutler Lab
Gene Symbol Sdc2
Ensembl Gene ENSMUSG00000022261
Gene Name syndecan 2
Synonyms 4833414L08Rik, Hspg1, Synd2, fibroglycan
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8838 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 32920723-33034935 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 33023751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 92 (L92*)
Ref Sequence ENSEMBL: ENSMUSP00000022871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022871]
AlphaFold P43407
Predicted Effect probably null
Transcript: ENSMUST00000022871
AA Change: L92*
SMART Domains Protein: ENSMUSP00000022871
Gene: ENSMUSG00000022261
AA Change: L92*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
4.1m 169 187 3.69e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-2 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-2 expression has been detected in several different tumor types. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,055 I1498F probably damaging Het
Aco2 T A 15: 81,911,927 N508K probably damaging Het
Aff4 T C 11: 53,406,638 S896P possibly damaging Het
Anapc2 T G 2: 25,273,534 V261G probably benign Het
Atm A G 9: 53,516,551 S420P probably damaging Het
Bag6 C T 17: 35,144,391 R736C probably damaging Het
Brca2 A G 5: 150,541,540 T1590A possibly damaging Het
Cacna2d3 C T 14: 28,969,263 C35Y probably benign Het
Cep170b G A 12: 112,743,725 R1433H probably damaging Het
Cmtm2a A G 8: 104,281,404 C138R probably damaging Het
Cntnap5c T A 17: 57,891,969 V86E Het
Cog7 A G 7: 121,949,883 I385T probably damaging Het
Col28a1 A T 6: 8,091,839 probably null Het
Dkk3 T C 7: 112,118,335 E309G probably benign Het
Dnah10 T C 5: 124,765,550 V1411A probably benign Het
Enox1 G T 14: 77,582,510 R235L probably benign Het
Foxn1 T C 11: 78,361,612 N317D possibly damaging Het
Grip2 G A 6: 91,785,740 probably benign Het
Hmmr T C 11: 40,714,027 T406A probably benign Het
Hpcal1 G A 12: 17,786,196 R9H probably benign Het
Iglv3 A T 16: 19,241,382 Y65* probably null Het
Itgal A G 7: 127,311,261 Y514C probably damaging Het
Kcnk9 T C 15: 72,546,170 E37G possibly damaging Het
Klhl40 A G 9: 121,780,041 D424G probably benign Het
Lbr A G 1: 181,820,729 L389P possibly damaging Het
Ly9 A G 1: 171,594,001 Y561H probably damaging Het
Mcoln3 T C 3: 146,139,371 F441L probably damaging Het
Muc20 G T 16: 32,793,459 T516K possibly damaging Het
Naa35 T C 13: 59,627,961 M551T probably benign Het
Nkx6-2 T A 7: 139,581,952 T170S probably damaging Het
Nlrp4c T A 7: 6,066,338 F413I Het
Olfr1054 T C 2: 86,332,973 K128E possibly damaging Het
Olfr1490 G A 19: 13,655,007 V193M probably damaging Het
Olfr1496 C A 19: 13,781,017 T133K probably benign Het
Olfr786 T G 10: 129,437,196 L128R probably damaging Het
Pcdhga10 C T 18: 37,748,899 T571I possibly damaging Het
Pla2g4a A T 1: 149,871,505 M310K probably benign Het
Plaa T C 4: 94,583,554 T353A probably benign Het
Rapgef1 T C 2: 29,737,446 F1172S possibly damaging Het
Rfx2 T C 17: 56,780,877 T505A possibly damaging Het
Rfx4 T C 10: 84,840,894 V216A probably damaging Het
Rps6kb2 G T 19: 4,161,184 A114D probably damaging Het
Slc18b1 A G 10: 23,820,866 Y319C probably benign Het
Slc22a15 A T 3: 101,883,533 Y219N probably damaging Het
Tarbp1 A T 8: 126,450,830 probably benign Het
Tfap2d T C 1: 19,104,812 L163P possibly damaging Het
Trank1 A G 9: 111,364,905 I666V probably benign Het
Trav14-1 G T 14: 53,554,552 A120S probably damaging Het
Trps1 T A 15: 50,889,611 N20I probably benign Het
Txndc16 A G 14: 45,140,571 Y682H probably damaging Het
Ube4a A T 9: 44,925,963 D991E probably damaging Het
Zswim4 C T 8: 84,214,070 R800Q probably damaging Het
Other mutations in Sdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Sdc2 UTSW 15 33017089 splice site probably benign
R1743:Sdc2 UTSW 15 33028078 missense probably benign
R4032:Sdc2 UTSW 15 33017177 missense probably damaging 1.00
R4577:Sdc2 UTSW 15 33017132 missense probably damaging 1.00
R4859:Sdc2 UTSW 15 33032456 missense probably damaging 1.00
R5800:Sdc2 UTSW 15 33028144 missense probably benign 0.02
R5918:Sdc2 UTSW 15 33028167 missense probably benign 0.12
R6782:Sdc2 UTSW 15 33028135 missense probably damaging 0.96
R7757:Sdc2 UTSW 15 33028087 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAGCCTGGTAACTTGAGAGC -3'
(R):5'- TGCAAGGAAAAGTGCCATTTTC -3'

Sequencing Primer
(F):5'- CCTGGTAACTTGAGAGCATGATTC -3'
(R):5'- TCCCTAAAGAAGATAGTCCTAGCTG -3'
Posted On 2021-07-15