Incidental Mutation 'R9623:Prpf6'
ID 724929
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Name pre-mRNA splicing factor 6
Synonyms ANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9623 (G1)
Quality Score 213.009
Status Not validated
Chromosome 2
Chromosomal Location 181591868-181655660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 181647344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 609 (V609M)
Ref Sequence ENSEMBL: ENSMUSP00000002529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000136481]
AlphaFold Q91YR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000002529
AA Change: V609M

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: V609M

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000136481
AA Change: V609M

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: V609M

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,325,467 N4D possibly damaging Het
Acsm2 A T 7: 119,582,752 Y408F probably benign Het
Adamts9 G T 6: 92,880,680 P876T probably benign Het
Afap1l2 T A 19: 56,918,030 D479V probably damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ampd3 A G 7: 110,803,100 E428G probably damaging Het
Apaf1 A T 10: 91,077,601 Y153* probably null Het
Arhgap10 T C 8: 77,259,157 T694A probably benign Het
Arhgef39 A G 4: 43,496,819 probably null Het
Arhgef5 T C 6: 43,274,802 V829A possibly damaging Het
Arrdc4 A G 7: 68,740,993 M333T Het
Boc G T 16: 44,501,655 R215S Het
Capn2 G A 1: 182,517,230 A42V probably benign Het
Ccdc136 T A 6: 29,405,940 M95K probably benign Het
Ccdc183 A T 2: 25,609,508 Y438N probably benign Het
Ccnf C A 17: 24,249,393 R10M probably damaging Het
Cd19 A G 7: 126,412,112 F300S probably damaging Het
Cdkl3 G T 11: 52,004,989 C21F probably damaging Het
Celf2 C T 2: 6,615,711 R183Q probably damaging Het
Clca1 T G 3: 145,013,937 D424A probably benign Het
Clec3a A G 8: 114,418,147 D21G probably benign Het
Clec4e T C 6: 123,286,347 N78S probably benign Het
Clpb A T 7: 101,664,192 S128C possibly damaging Het
Cntnap5a T A 1: 116,442,255 Y867* probably null Het
Dgkg G C 16: 22,566,444 N437K Het
Dnhd1 A G 7: 105,686,566 E1139G probably damaging Het
Dnhd1 G A 7: 105,694,927 R1826H probably damaging Het
Etl4 A G 2: 20,806,241 H1413R Het
Fam126a A C 5: 23,965,257 S365A probably benign Het
Fibp T A 19: 5,463,822 V271D possibly damaging Het
Gabra4 G T 5: 71,633,680 T273K probably damaging Het
Gan G A 8: 117,187,480 D206N probably damaging Het
Gstz1 A T 12: 87,160,149 I106F probably damaging Het
Hivep2 T G 10: 14,130,802 L1048R probably damaging Het
Htr6 A T 4: 139,074,439 M108K probably damaging Het
Itgad A G 7: 128,204,551 E1134G probably damaging Het
Lrp1b C T 2: 41,476,636 G657S Het
Lrp2 T C 2: 69,477,079 I2879V probably benign Het
Lyst G T 13: 13,678,002 V2196L probably benign Het
Mettl5 T A 2: 69,881,373 I50F possibly damaging Het
Mmadhc A G 2: 50,296,329 probably benign Het
Msantd1 G A 5: 34,917,732 W46* probably null Het
Mto1 T C 9: 78,457,430 I317T probably damaging Het
Myef2 T G 2: 125,115,457 D126A probably damaging Het
Net1 A G 13: 3,887,569 probably null Het
Nnmt A T 9: 48,592,360 M122K probably benign Het
Nos1 A G 5: 117,949,784 K1371E probably benign Het
Nrcam G C 12: 44,590,148 W1121C probably damaging Het
Nt5c2 A G 19: 46,888,970 S511P Het
Olfr1246 A G 2: 89,590,917 F66S probably benign Het
Olfr1490 C A 19: 13,655,050 A207E probably damaging Het
Olfr267 T C 4: 58,785,585 I46V possibly damaging Het
Olfr346 G T 2: 36,688,766 V255F probably benign Het
P2rx7 A G 5: 122,652,797 K66E probably damaging Het
Paqr4 A G 17: 23,737,682 W236R probably damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Pcbp2 T C 15: 102,484,193 Y178H probably damaging Het
Pidd1 G A 7: 141,441,765 P261S probably damaging Het
Pik3r6 T C 11: 68,551,333 V705A possibly damaging Het
Pla2g15 G T 8: 106,160,643 V156F possibly damaging Het
Rprd2 A G 3: 95,772,193 V491A probably benign Het
Rtp3 T A 9: 110,989,532 H27L probably damaging Het
Sema5b G A 16: 35,622,751 R42Q possibly damaging Het
Serpina3f A G 12: 104,217,484 K202E probably damaging Het
Slc25a33 T G 4: 149,749,310 M168L probably benign Het
Slc7a8 A G 14: 54,726,884 C371R probably damaging Het
Smyd1 T C 6: 71,215,824 N467S probably benign Het
Sptbn4 A G 7: 27,408,382 W872R probably damaging Het
Syne1 A T 10: 5,202,009 I5766N probably damaging Het
Syne2 A G 12: 75,939,986 S1699G probably benign Het
Synpo2 T C 3: 123,114,398 D423G possibly damaging Het
Tcf19 A T 17: 35,514,895 F122I probably damaging Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Trappc8 T A 18: 20,850,918 H681L possibly damaging Het
Trim36 A G 18: 46,175,556 F413S probably benign Het
Tsks A G 7: 44,956,507 T466A possibly damaging Het
Ubr1 T C 2: 120,934,339 I545V probably benign Het
Ubr4 A G 4: 139,431,713 E1170G probably benign Het
Usp29 A G 7: 6,961,397 R80G possibly damaging Het
Utrn C T 10: 12,406,481 R3258H probably damaging Het
Vmn1r13 T G 6: 57,210,564 V236G probably benign Het
Vmn1r33 T A 6: 66,612,018 D184V probably damaging Het
Vmn2r87 T C 10: 130,479,925 N91D probably damaging Het
Wrn A G 8: 33,284,616 probably null Het
Zan G A 5: 137,463,374 P1181L unknown Het
Zfc3h1 C A 10: 115,423,457 L1645I possibly damaging Het
Zfhx2 G T 14: 55,064,734 P1931Q probably damaging Het
Zfp352 A G 4: 90,224,891 K423E probably benign Het
Zfp574 T A 7: 25,081,090 H512Q Het
Zfp651 C A 9: 121,762,924 Y103* probably null Het
Zfp7 G A 15: 76,890,331 R191H probably benign Het
Zfp771 A T 7: 127,245,129 K46* probably null Het
Zkscan8 T C 13: 21,520,593 E392G probably damaging Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
IGL02837:Prpf6 UTSW 2 181622263 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6152:Prpf6 UTSW 2 181621787 missense probably damaging 1.00
R6252:Prpf6 UTSW 2 181647363 missense probably damaging 1.00
R6317:Prpf6 UTSW 2 181631436 missense probably benign 0.06
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R6789:Prpf6 UTSW 2 181616051 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
R7538:Prpf6 UTSW 2 181652455 missense probably benign 0.16
R7696:Prpf6 UTSW 2 181608242 missense possibly damaging 0.88
R8020:Prpf6 UTSW 2 181645570 missense probably benign 0.05
R8345:Prpf6 UTSW 2 181650158 missense probably benign
R8786:Prpf6 UTSW 2 181620622 missense possibly damaging 0.77
R9151:Prpf6 UTSW 2 181608208 missense possibly damaging 0.70
RF016:Prpf6 UTSW 2 181632076 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTCTCCCCATCGTAAAATCTTG -3'
(R):5'- TGTCTCTAGACTAGACCATGGC -3'

Sequencing Primer
(F):5'- CTCCCCATCGTAAAATCTTGTAAATC -3'
(R):5'- GTCTCTAGACTAGACCATGGCATATC -3'
Posted On 2022-09-12