Incidental Mutation 'R0801:Ero1lb'
ID76293
Institutional Source Beutler Lab
Gene Symbol Ero1lb
Ensembl Gene ENSMUSG00000057069
Gene NameERO1-like beta (S. cerevisiae)
Synonyms
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0801 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12565874-12611396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12581687 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 123 (S123G)
Ref Sequence ENSEMBL: ENSMUSP00000152543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071973] [ENSMUST00000220811] [ENSMUST00000221560]
Predicted Effect probably benign
Transcript: ENSMUST00000071973
AA Change: S123G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071864
Gene: ENSMUSG00000057069
AA Change: S123G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:ERO1 56 456 2.5e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220811
AA Change: S123G

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000221560
AA Change: S123G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221739
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased circulating glucose levels, decreased pancreas insulin levels, and disorganized islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc174 A G 6: 91,895,332 E314G possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ern2 A G 7: 122,180,862 probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Map2k5 T A 9: 63,357,979 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdga2 A T 12: 66,486,733 I878K probably damaging Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Olfr525 G A 7: 140,322,918 C73Y probably damaging Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Srgap1 A T 10: 121,807,875 F612L probably damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Ero1lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Ero1lb APN 13 12601734 critical splice acceptor site probably null
IGL02738:Ero1lb APN 13 12604433 missense possibly damaging 0.94
IGL03033:Ero1lb APN 13 12581670 missense probably damaging 1.00
R0607:Ero1lb UTSW 13 12574866 missense probably damaging 1.00
R1665:Ero1lb UTSW 13 12579261 critical splice donor site probably null
R1851:Ero1lb UTSW 13 12604403 missense possibly damaging 0.61
R1928:Ero1lb UTSW 13 12601759 missense probably damaging 1.00
R2910:Ero1lb UTSW 13 12600289 missense probably damaging 1.00
R3719:Ero1lb UTSW 13 12583612 critical splice donor site probably null
R4873:Ero1lb UTSW 13 12604436 missense probably damaging 0.99
R4875:Ero1lb UTSW 13 12604436 missense probably damaging 0.99
R5053:Ero1lb UTSW 13 12599906 missense probably damaging 1.00
R5338:Ero1lb UTSW 13 12574851 missense probably damaging 1.00
R5415:Ero1lb UTSW 13 12601767 missense probably benign 0.02
R5800:Ero1lb UTSW 13 12602301 splice site probably null
R5907:Ero1lb UTSW 13 12600318 missense probably damaging 0.98
R5909:Ero1lb UTSW 13 12579258 missense probably benign 0.18
R6029:Ero1lb UTSW 13 12574833 missense probably damaging 1.00
R7234:Ero1lb UTSW 13 12600314 missense possibly damaging 0.72
R7331:Ero1lb UTSW 13 12600126 missense probably damaging 1.00
R7577:Ero1lb UTSW 13 12602365 missense probably damaging 0.99
R7726:Ero1lb UTSW 13 12605833 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGACAACATCACTAGCACACTATTGCAT -3'
(R):5'- GGCTCAGCTCCTTCCGCACA -3'

Sequencing Primer
(F):5'- GCACACTATTGCATTTTAAATGCC -3'
(R):5'- tggtagtgcagaggcagg -3'
Posted On2013-10-16