Mutagenetix > Incidental Mutation

Incidental Mutation 'R0993:Etv1'

97864

Institutional Source

Beutler Lab

Gene Symbol

Etv1

Ensembl Gene

ENSMUSG00000004151

Gene Name

ets variant 1

Synonyms

Etsrp81, ER81

MMRRC Submission

039113-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.448) question?

Stock #

R0993 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38829655-38920484 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 38877863 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 68 (P68S)

Ref Sequence

ENSEMBL: ENSMUSP00000125676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000160996] [ENSMUST00000161513] [ENSMUST00000162563] [ENSMUST00000161980]

AlphaFold

P41164

Predicted Effect

probably benign
Transcript: ENSMUST00000095767
AA Change: P108S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: P108S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	333	5e-153	PFAM
ETS	334	419	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159334
AA Change: P68S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: P68S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	16	293	1.1e-112	PFAM
ETS	294	379	1.72e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160244
AA Change: P108S

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151
AA Change: P108S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	310	2.5e-133	PFAM
ETS	311	396	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160701
AA Change: P68S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: P68S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	14	82	1.4e-30	PFAM
Pfam:ETS_PEA3_N	80	230	1.6e-68	PFAM
ETS	231	316	1.72e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160856
AA Change: P90S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: P90S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	315	3.8e-130	PFAM
ETS	316	401	1.72e-57	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160996
AA Change: P90S

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124705
Gene: ENSMUSG00000004151
AA Change: P90S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	230	1.9e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161513
AA Change: P124S

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124166
Gene: ENSMUSG00000004151
AA Change: P124S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	23	210	8.5e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162563
AA Change: P108S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: P108S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	333	5.6e-150	PFAM
ETS	334	419	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161980
AA Change: P50S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: P50S

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	10	275	3.2e-104	PFAM
ETS	276	361	1.72e-57	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220492

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
D6Ertd527e	C	G	6: 87,088,506 (GRCm39)	T223S	unknown	Het
Eml5	T	C	12: 98,827,442 (GRCm39)	E596G	probably benign	Het
Eri3	C	A	4: 117,421,860 (GRCm39)	T46K	possibly damaging	Het
Fbxl8	C	A	8: 105,993,717 (GRCm39)	D24E	probably damaging	Het
Gm19965	A	T	1: 116,749,555 (GRCm39)	N412I	probably benign	Het
Lmbr1	T	A	5: 29,492,391 (GRCm39)	H66L	probably damaging	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Or8j3b	T	G	2: 86,205,222 (GRCm39)	Y178S	probably damaging	Het
Polr1has	TCACCACCACCACCACCACCACCAC	TCACCACCACCACCACCACCAC	17: 37,275,939 (GRCm39)		probably benign	Het
Prl2c2	G	C	13: 13,176,786 (GRCm39)	T47R	probably damaging	Het
Samd8	T	A	14: 21,825,563 (GRCm39)	V173D	probably damaging	Het
Shf	G	A	2: 122,199,163 (GRCm39)	P51S	probably damaging	Het
Slc2a9	T	A	5: 38,539,406 (GRCm39)	T365S	probably damaging	Het
Slc32a1	T	C	2: 158,453,340 (GRCm39)	M60T	possibly damaging	Het
Slx4	T	C	16: 3,803,689 (GRCm39)	S1042G	probably benign	Het
Stard9	T	C	2: 120,535,650 (GRCm39)	L193P	probably damaging	Het
Tln1	T	C	4: 43,549,825 (GRCm39)	K529E	probably benign	Het
Vps13d	G	A	4: 144,844,262 (GRCm39)	R1342*	probably null	Het

Other mutations in Etv1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Etv1	APN	12	38,831,791 (GRCm39)	splice site	probably benign
IGL01376:Etv1	APN	12	38,907,039 (GRCm39)	missense	probably damaging	1.00
IGL01387:Etv1	APN	12	38,911,326 (GRCm39)	missense	probably damaging	0.99
IGL01936:Etv1	APN	12	38,885,060 (GRCm39)	splice site	probably benign
IGL02388:Etv1	APN	12	38,831,798 (GRCm39)	missense	possibly damaging	0.62
IGL02933:Etv1	APN	12	38,831,832 (GRCm39)	missense	probably benign	0.22
R0844:Etv1	UTSW	12	38,911,353 (GRCm39)	missense	probably damaging	1.00
R1187:Etv1	UTSW	12	38,915,563 (GRCm39)	missense	probably damaging	1.00
R1710:Etv1	UTSW	12	38,902,261 (GRCm39)	missense	probably benign	0.18
R2094:Etv1	UTSW	12	38,885,115 (GRCm39)	missense	probably null	1.00
R2879:Etv1	UTSW	12	38,833,809 (GRCm39)	splice site	probably null
R3607:Etv1	UTSW	12	38,881,085 (GRCm39)	missense	probably damaging	1.00
R4353:Etv1	UTSW	12	38,907,105 (GRCm39)	missense	probably damaging	1.00
R4646:Etv1	UTSW	12	38,915,685 (GRCm39)	missense	possibly damaging	0.94
R4678:Etv1	UTSW	12	38,885,219 (GRCm39)	missense	probably damaging	1.00
R4768:Etv1	UTSW	12	38,877,792 (GRCm39)	missense	probably damaging	1.00
R4812:Etv1	UTSW	12	38,911,287 (GRCm39)	missense	probably damaging	1.00
R4877:Etv1	UTSW	12	38,881,292 (GRCm39)	splice site	probably null
R5024:Etv1	UTSW	12	38,904,233 (GRCm39)	splice site	probably null
R5253:Etv1	UTSW	12	38,902,248 (GRCm39)	missense	possibly damaging	0.50
R5936:Etv1	UTSW	12	38,885,209 (GRCm39)	missense	probably damaging	1.00
R6085:Etv1	UTSW	12	38,904,194 (GRCm39)	missense	probably damaging	1.00
R6167:Etv1	UTSW	12	38,915,640 (GRCm39)	missense	possibly damaging	0.88
R6709:Etv1	UTSW	12	38,833,796 (GRCm39)	missense	possibly damaging	0.93
R7046:Etv1	UTSW	12	38,834,369 (GRCm39)	splice site	probably null
R7243:Etv1	UTSW	12	38,907,045 (GRCm39)	missense	probably benign	0.36
R7616:Etv1	UTSW	12	38,915,605 (GRCm39)	missense	probably damaging	1.00
R8230:Etv1	UTSW	12	38,830,935 (GRCm39)	start codon destroyed	probably null	1.00
R9021:Etv1	UTSW	12	38,830,971 (GRCm39)	missense	probably benign	0.01
R9182:Etv1	UTSW	12	38,830,716 (GRCm39)	critical splice donor site	probably null
R9687:Etv1	UTSW	12	38,911,361 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCATGAGATCACTGCTACTGAAGCAA -3'
(R):5'- CACCACAGTGGAAAAGCAACTGATG -3'

Sequencing Primer
(F):5'- CCAaagcaaaaaaaaaacaaacaaac -3'
(R):5'- GCAACTGATGGTTGAGATGAG -3'

Posted On

2014-01-05