Phenotypic Mutation 'twerk' (pdf version)
Allele | twerk |
Mutation Type |
missense
|
Chromosome | 10 |
Coordinate | 60,300,851 bp (GRCm38) |
Base Change | T ⇒ G (forward strand) |
Gene |
Psap
|
Gene Name | prosaposin |
Synonym(s) | SGP-1 |
Chromosomal Location |
60,277,627-60,302,597 bp (+)
|
MGI Phenotype |
FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015] PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001146120 (variant 1), NM_011179 (variant 2), NM_001146121 (variant 3), NM_001146122 (variant 4), NM_001146123 (variant 5), NM_001146124 (variant 6); MGI:97783
|
Mapped | Yes |
Amino Acid Change |
Cysteine changed to Tryptophan
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000004316]
[ENSMUSP00000101105]
[ENSMUSP00000126407]
[ENSMUSP00000137286]
[ENSMUSP00000137476]
|
---|
SMART Domains |
Protein: ENSMUSP00000004316 Gene: ENSMUSG00000004207 AA Change: C535W
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
SAPA
|
21 |
54 |
1.4e-18 |
SMART |
SapB
|
61 |
138 |
1.87e-27 |
SMART |
SapB
|
195 |
272 |
1.2e-16 |
SMART |
SapB
|
314 |
389 |
2.07e-20 |
SMART |
low complexity region
|
412 |
430 |
N/A |
INTRINSIC |
SapB
|
439 |
514 |
3.84e-24 |
SMART |
SAPA
|
523 |
556 |
3.19e-22 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000004316)
|
SMART Domains |
Protein: ENSMUSP00000101105 Gene: ENSMUSG00000004207 AA Change: C533W
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
SAPA
|
21 |
54 |
1.4e-18 |
SMART |
SapB
|
61 |
138 |
1.87e-27 |
SMART |
SapB
|
195 |
270 |
2.76e-16 |
SMART |
SapB
|
312 |
387 |
2.07e-20 |
SMART |
low complexity region
|
410 |
428 |
N/A |
INTRINSIC |
SapB
|
437 |
512 |
3.84e-24 |
SMART |
SAPA
|
521 |
554 |
3.19e-22 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000105465)
|
SMART Domains |
Protein: ENSMUSP00000126407 Gene: ENSMUSG00000004207 AA Change: C530W
Domain | Start | End | E-Value | Type |
SAPA
|
18 |
51 |
1.4e-18 |
SMART |
SapB
|
58 |
135 |
1.87e-27 |
SMART |
SapB
|
192 |
267 |
2.76e-16 |
SMART |
SapB
|
309 |
384 |
2.07e-20 |
SMART |
low complexity region
|
407 |
425 |
N/A |
INTRINSIC |
SapB
|
434 |
509 |
3.84e-24 |
SMART |
SAPA
|
518 |
551 |
3.19e-22 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000165878)
|
SMART Domains |
Protein: ENSMUSP00000137286 Gene: ENSMUSG00000004207 AA Change: C536W
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
SAPA
|
21 |
54 |
1.4e-18 |
SMART |
SapB
|
61 |
138 |
1.87e-27 |
SMART |
SapB
|
195 |
273 |
2.37e-15 |
SMART |
SapB
|
315 |
390 |
2.07e-20 |
SMART |
low complexity region
|
413 |
431 |
N/A |
INTRINSIC |
SapB
|
440 |
515 |
3.84e-24 |
SMART |
SAPA
|
524 |
557 |
3.19e-22 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000177779)
|
SMART Domains |
Protein: ENSMUSP00000137476 Gene: ENSMUSG00000004207 AA Change: C536W
Domain | Start | End | E-Value | Type |
signal peptide
|
1 |
16 |
N/A |
INTRINSIC |
SAPA
|
21 |
54 |
1.4e-18 |
SMART |
SapB
|
61 |
138 |
1.87e-27 |
SMART |
SapB
|
195 |
273 |
8.5e-17 |
SMART |
SapB
|
315 |
390 |
2.07e-20 |
SMART |
low complexity region
|
413 |
431 |
N/A |
INTRINSIC |
SapB
|
440 |
515 |
3.84e-24 |
SMART |
SAPA
|
524 |
557 |
3.19e-22 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000179238)
|
Meta Mutation Damage Score |
0.6467  |
Is this an essential gene? |
Essential (E-score: 1.000)  |
Phenotypic Category |
Phenotype |
Literature verified |
References |
behavior/neurological |
✔ |
17353235
|
|
Candidate Explorer Status |
CE: failed initial filter
|
---|
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(16) : Chemically induced (other)(1) Gene trapped(4) Radiation induced(1) Targeted(10)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00926:Psap
|
APN |
10 |
60292536 |
missense |
probably damaging |
1.00 |
IGL01100:Psap
|
APN |
10 |
60299929 |
missense |
probably benign |
0.03 |
IGL01122:Psap
|
APN |
10 |
60299474 |
missense |
probably benign |
0.04 |
IGL02544:Psap
|
APN |
10 |
60300626 |
splice site |
probably benign |
|
R0591:Psap
|
UTSW |
10 |
60300855 |
missense |
possibly damaging |
0.65 |
R0624:Psap
|
UTSW |
10 |
60299566 |
splice site |
probably benign |
|
R1018:Psap
|
UTSW |
10 |
60300811 |
missense |
probably damaging |
1.00 |
R1896:Psap
|
UTSW |
10 |
60295046 |
nonsense |
probably null |
|
R3161:Psap
|
UTSW |
10 |
60277753 |
missense |
possibly damaging |
0.95 |
R3162:Psap
|
UTSW |
10 |
60277753 |
missense |
possibly damaging |
0.95 |
R3162:Psap
|
UTSW |
10 |
60277753 |
missense |
possibly damaging |
0.95 |
R3615:Psap
|
UTSW |
10 |
60294603 |
missense |
probably benign |
0.06 |
R3616:Psap
|
UTSW |
10 |
60294603 |
missense |
probably benign |
0.06 |
R4622:Psap
|
UTSW |
10 |
60300851 |
missense |
probably damaging |
1.00 |
R4623:Psap
|
UTSW |
10 |
60300851 |
missense |
probably damaging |
1.00 |
R4666:Psap
|
UTSW |
10 |
60300545 |
missense |
probably benign |
|
R5131:Psap
|
UTSW |
10 |
60299957 |
missense |
possibly damaging |
0.72 |
R5203:Psap
|
UTSW |
10 |
60294975 |
missense |
probably damaging |
1.00 |
R5251:Psap
|
UTSW |
10 |
60301700 |
missense |
probably damaging |
0.99 |
R5511:Psap
|
UTSW |
10 |
60299180 |
missense |
possibly damaging |
0.51 |
R5764:Psap
|
UTSW |
10 |
60293406 |
missense |
probably benign |
0.18 |
R6207:Psap
|
UTSW |
10 |
60300538 |
missense |
probably damaging |
1.00 |
R7003:Psap
|
UTSW |
10 |
60299497 |
missense |
probably damaging |
1.00 |
R7494:Psap
|
UTSW |
10 |
60299496 |
missense |
probably benign |
0.00 |
R7525:Psap
|
UTSW |
10 |
60299474 |
missense |
probably benign |
0.04 |
R7711:Psap
|
UTSW |
10 |
60299855 |
missense |
probably damaging |
0.96 |
R8252:Psap
|
UTSW |
10 |
60277689 |
start gained |
probably benign |
|
X0019:Psap
|
UTSW |
10 |
60299915 |
missense |
probably damaging |
0.96 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | Live Mice |
Repository | |
Last Updated |
2019-09-04 9:42 PM
by Anne Murray
|
Record Created |
2016-08-16 2:37 PM
by Jamie Russell
|
Record Posted |
2018-11-16 |
Phenotypic Description |
The twerk phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4622, some of which exhibited ataxia (Figure 1). |
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 102 mutations. The ataxia phenotype was attributed to a mutation in Psap; mutations in Psap are known to cause ataxia (see MGI). The mutation in Psap is a T to G transversion at base pair 60,300,851 (v38) on chromosome 10, or base pair 23,224 in the GenBank genomic region NC_000076 encoding Psap. Linkage was found with a recessive model of inheritance, wherein two homozygous variant mice departed phenotypically from eight homozygous reference mice and nine heterozygous mice with a P value of 0.002881 (Figure 2).
The mutation corresponds to residue 1,714 in the mRNA sequence NM_001146120 within exon 13 of 14 total exons.
1697 GGCCCTAGCTACTGGTGTCAGAACATGGAGACT
528 -G--P--S--Y--W--C--Q--N--M--E--T-
|
The mutated nucleotide is indicated in red. The mutation results in a cysteine to tryptophan substitution at amino acid 533 (C533W) in the PSAP protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).
|
Protein Prediction |
Psap encodes prosaposin (PSAP; alternatively, spingolipid activator protein 1 [SAP1], SAP2, or sulfated glycoprotein 1 [SGP-1]). PSAP is a precursor protein for four lysosomal activator proteins: saposin A through D (Figure 3) (1). The saposins remodel lysosomal membranes to promote the extraction of substrate lipids (i.e., sphingolipids) from the membranes for presentation to hydrolase enzymes (1-4). Each of the saposins exhibit unique substrate specificity. Saposin A and C stimulate the hydrolysis of glucosylceramide by beta-glucosylceramidase. Saposin B stimulates the hydrolysis of galactocerebroside sulfate by arylsulfatase A, GM1 (monosialotetrahexosylganglioside) gangliosides by beta-galactosidase, and globotriaosylceramide by alpha-galactosidase A. Saposin-D is a specific sphingomyelin phosphodiesterase activator.
The four saposins are approximately 80-amino acids in length and are structurally similar, with each sharing the placement of six cysteines, a glycosylation site, and two conserved prolines in identical positions (1;5). Each saposin is highly structured and rich in a-helical regions (5). Saposin A, C, and D putatively form triple helix structures that are stabilized by disulfide linkages (6;7). The first 24-amino acids of saposin B are putatively in a b-sheet configuration, but the comparable region in the other saposins is helical (5).
The twerk mutation results in a cysteine to tryptophan substitution at amino acid 533; Cys533 is within in a saposin A-type domain (SMART) following the saposin D peptide. The saposin A-type domain putatively regulates protein targeting.
|
Expression/Localization | PSAP can be secreted into the extracellular space; PSAP secretion is increased under conditions of injury and stress. PSAP can subsequently be re-uptaken by the same cell or by neighboring cells (8;9). Saposins are expressed in most tissues, including liver, spleen, brain, placenta, and saliva (1). The saposins are processed from PSAP in the late endosome and lysosome; mature saposins are localized to lysosomes (1;5).
|
Background |
PSAP can be secreted into cerebrospinal fluid, semen, milk, pancreatic juice, and bile (10). PSAP is re-uptaken into cells by the endocytic receptor LRP-1. Secreted PSAP can function as a neurotrophic factor that promotes cell survival, neurite outgrowth, and differentiation (Figure 4) (11;12). Secreted PSAP activates G protein pathways to protect neurons and glia by stimulating two orphan G protein-coupled receptors: GPR37 and GPR37L1 (13). GPR37 and GPR37L1 are mainly expressed in neurons and glia of the nervous system where they putatively protect cells from oxidative stress and cell death (13-15).
PSAP stimulates ERK and Akt phosphorylation in several cell types. PSAP-stimulated ERK phosphorylation promoted proliferation, survival, migration, and invasion of cancer cells (16), prevented oxidative cell death in PC12 cells (17), and promoted cell cycle progression in PC12 cells (18). PSAP-stimulated Akt phosphorylation promoted Schwann cell survival (19), prevented oxidative cell death in PC12 cells (17), and protected prostate cancer cells from apoptosis (20).
Loss of (pro)saposin function is linked to several human lysosomal storage diseases including atypical Krabbe disease (OMIM:#611722; alternatively, globoid cell leukodystrophy [GLD]) (21), atypical Gaucher disease [OMIM:#610539;(22-25)], and metachromatic leukodystrophy due to saposin B deficiency [OMIM:#249900; (26-29)]. Patients with atypical Krabbe disease, atypical Gaucher disease, and metachromatic leukodystrophy show neurological defects, including transient losses of consciousness, myoclonic jerks, and generalized seizures (21;24;27). Mutations in PSAP are also linked to combined saposin deficiency (OMIM:#611721; alternatively, posaposin deficiency; (30-32)). Patients with combined saposin deficiency showed respiratory insufficiency, hepatosplenomegaly, and neurological disease as well as storage cells in the bone marrow and elevated levels of glucosylceramide and ceramide in the liver (30;31).
PSAP-deficient (PSAP-/-) mice exhibit increased rates of embryonic and neonatal lethality (33-35). Surviving mice showed smaller body sizes than wild-type littermates, head tremors, and weakness/ataxia of the hind legs (33;36). The mice showed intermittent seizures by postnatal day 30 that progressed to continual tonic status epilepticus. The PSAP-/- mice showed reduced hearing at postnatal day 19, but deafness by postnatal day 25 due to a loss of outer hair cells from the cochlear apex, vacuolization of the outer hair cells, and cellular hypertrophy in the region of the inner hair cells (37). The mice had dystrophic axons, neuronal storage, hypomyelination, and myelin degeneration. The mice died by approximately postnatal day 35 (33;36). The brains, liver, and kidneys from the PSAP-/- brain showed lactosylceramide accumulation. The PSAP-/- testis size was decreased with reduced spermiogenesis, and the prostate, seminal vesicle, and epididymis of the PSAP-/- mice were involuted (35). Several groups have knocked out one or more of the individual saposin proteins. The models showed variable phenotypes, but all exhibited neurological defects, hindlimb weakness, tremors, and motor neuron deterioration (38-40).
Table 1. Phenotypes of saposin knockout mice.
Saposin knockout
|
Primary phenotypes
|
References
|
A
|
Survived up to five months of age; progressive hind limb paralysis; chronic form of globoid cell leukodystrophy
|
(34;41)
|
B
|
Progressive neuromotor deterioration and hear tremor by 15 months of age; increased levels of fatty acid sulfatides in the brain and kidney; sulfatide storage cells in the brain, spinal cord, and kidney
|
(38)
|
A and B
|
Later-onset (>61 days) neuromotor deterioration, abnormal locomotor activity, and tremor; storage materials in Schwann cells and neuronal processes; increased levels of lactosylceramide in the liver
|
(39)
|
C
|
Weakness of the hind limbs and progressive ataxia by one year of age; neuromotor activity and impaired hippocampal long-term potentiation; storage cells in dorsal root ganglion; progressive loss of cerebellar Purkinje cells; atrophy of cerebellar granule cells
|
(42)
|
D
|
Progressive polyuria and ataxia; renal tubular degeneration and hydronephrosis; nervous system showed progressive loss of Purkinje cells; accumulation of ceramides in the kidney and brain
|
(43)
|
C and D
|
Ataxia, kyphosis, and hind limb paralysis; loss of Purkinje cells, the presence of storage bodies in neurons of the spinal cord, brain, and dorsal root ganglion, and accumulation of glucosylceramides and alpha-hydroxy ceramides were present in brain and kidney
|
(44)
|
|
Putative Mechanism | The functions of each of the indvidual saposins in the twerk mice were not examined. The overt neurological phenotype observed in the twerk mice mimics that of the PSAP-/- and individual saposin knockout mice, indicating loss of PSAP-associated function.
|
Primers |
PCR Primer
twerk_pcr_F: AACAGCCAGACCTCTGTCAG
twerk_pcr_R: AGGTTTGGTGCAATCCCTGG
Sequencing Primer
twerk_seq_F: CTCTGTCAGGGGCTGGAAG
twerk_seq_R: CTGTGCATGAAGCTGGTAAGAC
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 422 nucleotides is amplified (chromosome 10, + strand):
1 aacagccaga cctctgtcag gggctggaag tgcttcggtc tcagctctga atggggcctg 61 gcagggcagc tcatttctcg tcatttgtca tacagaaaat tggagtttgc ccttctgcct 121 ataagctgct gctgggaacc gagaagtgtg tctggggccc tagctactgg tgtcagaaca 181 tggagactgc cgcccgatgc aatgtgagta tcctgactgc tcctacagcg tgctgggggg 241 tggatcacct catgggaaca ggaggctcta actgtgcctc taacaagtca tcttgtcggg 301 gatgactgag ctcagggcat taggcctgcg tggctatgct ttttgtcttt tgagccatct 361 ctgtgtcccc tggtattgtc ttaccagctt catgcacagc caccagggat tgcaccaaac 421 ct
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
6. Morimoto, S., Martin, B. M., Yamamoto, Y., Kretz, K. A., O'Brien, J. S., and Kishimoto, Y. (1989) Saposin A: Second Cerebrosidase Activator Protein. Proc Natl Acad Sci U S A. 86, 3389-3393.
7. O'Brien, J. S., Kretz, K. A., Dewji, N., Wenger, D. A., Esch, F., and Fluharty, A. L. (1988) Coding of Two Sphingolipid Activator Proteins (SAP-1 and SAP-2) by Same Genetic Locus. Science. 241, 1098-1101.
8. Hiesberger, T., Huttler, S., Rohlmann, A., Schneider, W., Sandhoff, K., and Herz, J. (1998) Cellular Uptake of Saposin (SAP) Precursor and Lysosomal Delivery by the Low Density Lipoprotein Receptor-Related Protein (LRP). EMBO J. 17, 4617-4625.
10. Hineno, T., Sano, A., Kondoh, K., Ueno, S., Kakimoto, Y., and Yoshida, K. (1991) Secretion of Sphingolipid Hydrolase Activator Precursor, Prosaposin. Biochem Biophys Res Commun. 176, 668-674.
11. O'Brien, J. S., Carson, G. S., Seo, H. C., Hiraiwa, M., Weiler, S., Tomich, J. M., Barranger, J. A., Kahn, M., Azuma, N., and Kishimoto, Y. (1995) Identification of the Neurotrophic Factor Sequence of Prosaposin. FASEB J. 9, 681-685.
12. O'Brien, J. S., Carson, G. S., Seo, H. C., Hiraiwa, M., and Kishimoto, Y. (1994) Identification of Prosaposin as a Neurotrophic Factor. Proc Natl Acad Sci U S A. 91, 9593-9596.
14. Lundius, E. G., Stroth, N., Vukojevic, V., Terenius, L., and Svenningsson, P. (2013) Functional GPR37 Trafficking Protects Against Toxicity Induced by 6-OHDA, MPP+ Or Rotenone in a Catecholaminergic Cell Line. J Neurochem. 124, 410-417.
15. Lundius, E. G., Vukojevic, V., Hertz, E., Stroth, N., Cederlund, A., Hiraiwa, M., Terenius, L., and Svenningsson, P. (2014) GPR37 Protein Trafficking to the Plasma Membrane Regulated by Prosaposin and GM1 Gangliosides Promotes Cell Viability. J Biol Chem. 289, 4660-4673.
16. Koochekpour, S., Sartor, O., Lee, T. J., Zieske, A., Patten, D. Y., Hiraiwa, M., Sandhoff, K., Remmel, N., and Minokadeh, A. (2004) Prosaptide TX14A Stimulates Growth, Migration, and Invasion and Activates the Raf-MEK-ERK-RSK-Elk-1 Signaling Pathway in Prostate Cancer Cells. Prostate. 61, 114-123.
17. Ochiai, T., Takenaka, Y., Kuramoto, Y., Kasuya, M., Fukuda, K., Kimura, M., Shimeno, H., Misasi, R., Hiraiwa, M., and Soeda, S. (2008) Molecular Mechanism for Neuro-Protective Effect of Prosaposin Against Oxidative Stress: Its Regulation of Dimeric Transcription Factor Formation. Biochim Biophys Acta. 1780, 1441-1447.
18. Misasi, R., Sorice, M., Di Marzio, L., Campana, W. M., Molinari, S., Cifone, M. G., Pavan, A., Pontieri, G. M., and O'Brien, J. S. (2001) Prosaposin Treatment Induces PC12 Entry in the S Phase of the Cell Cycle and Prevents Apoptosis: Activation of ERKs and Sphingosine Kinase. FASEB J. 15, 467-474.
21. Spiegel, R., Bach, G., Sury, V., Mengistu, G., Meidan, B., Shalev, S., Shneor, Y., Mandel, H., and Zeigler, M. (2005) A Mutation in the Saposin A Coding Region of the Prosaposin Gene in an Infant Presenting as Krabbe Disease: First Report of Saposin A Deficiency in Humans. Mol Genet Metab. 84, 160-166.
23. Diaz-Font, A., Cormand, B., Santamaria, R., Vilageliu, L., Grinberg, D., and Chabas, A. (2005) A Mutation within the Saposin D Domain in a Gaucher Disease Patient with Normal Glucocerebrosidase Activity. Hum Genet. 117, 275-277.
25. Tylki-Szymanska, A., Czartoryska, B., Vanier, M. T., Poorthuis, B. J., Groener, J. A., Lugowska, A., Millat, G., Vaccaro, A. M., and Jurkiewicz, E. (2007) Non-Neuronopathic Gaucher Disease due to Saposin C Deficiency. Clin Genet. 72, 538-542.
26. Kretz, K. A., Carson, G. S., Morimoto, S., Kishimoto, Y., Fluharty, A. L., and O'Brien, J. S. (1990) Characterization of a Mutation in a Family with Saposin B Deficiency: A Glycosylation Site Defect. Proc Natl Acad Sci U S A. 87, 2541-2544.
27. Henseler, M., Klein, A., Reber, M., Vanier, M. T., Landrieu, P., and Sandhoff, K. (1996) Analysis of a Splice-Site Mutation in the Sap-Precursor Gene of a Patient with Metachromatic Leukodystrophy. Am J Hum Genet. 58, 65-74.
29. Shapiro, L. J., Aleck, K. A., Kaback, M. M., Itabashi, H., Desnick, R. J., Brand, N., Stevens, R. L., Fluharty, A. L., and Kihara, H. (1979) Metachromatic Leukodystrophy without Arylsulfatase A Deficiency. Pediatr Res. 13, 1179-1181.
30. Harzer, K., Paton, B. C., Poulos, A., Kustermann-Kuhn, B., Roggendorf, W., Grisar, T., and Popp, M. (1989) Sphingolipid Activator Protein Deficiency in a 16-Week-Old Atypical Gaucher Disease Patient and His Fetal Sibling: Biochemical Signs of Combined Sphingolipidoses. Eur J Pediatr. 149, 31-39.
31. Hulkova, H., Cervenkova, M., Ledvinova, J., Tochackova, M., Hrebicek, M., Poupetova, H., Befekadu, A., Berna, L., Paton, B. C., Harzer, K., Boor, A., Smid, F., and Elleder, M. (2001) A Novel Mutation in the Coding Region of the Prosaposin Gene Leads to a Complete Deficiency of Prosaposin and Saposins, and is Associated with a Complex Sphingolipidosis Dominated by Lactosylceramide Accumulation. Hum Mol Genet. 10, 927-940.
32. Schnabel, D., Schroder, M., Furst, W., Klein, A., Hurwitz, R., Zenk, T., Weber, J., Harzer, K., Paton, B. C., and Poulos, A. (1992) Simultaneous Deficiency of Sphingolipid Activator Proteins 1 and 2 is Caused by a Mutation in the Initiation Codon of their Common Gene. J Biol Chem. 267, 3312-3315.
33. Fujita, N., Suzuki, K., Vanier, M. T., Popko, B., Maeda, N., Klein, A., Henseler, M., Sandhoff, K., Nakayasu, H., and Suzuki, K. (1996) Targeted Disruption of the Mouse Sphingolipid Activator Protein Gene: A Complex Phenotype, Including Severe Leukodystrophy and Wide-Spread Storage of Multiple Sphingolipids. Hum Mol Genet. 5, 711-725.
34. Tadano-Aritomi, K., Matsuda, J., Fujimoto, H., Suzuki, K., and Ishizuka, I. (2003) Seminolipid and its precursor/degradative Product, Galactosylalkylacylglycerol, in the Testis of Saposin A- and Prosaposin-Deficient Mice. J Lipid Res. 44, 1737-1743.
36. Oya, Y., Nakayasu, H., Fujita, N., Suzuki, K., and Suzuki, K. (1998) Pathological Study of Mice with Total Deficiency of Sphingolipid Activator Proteins (SAP Knockout Mice). Acta Neuropathol. 96, 29-40.
37. Akil, O., Chang, J., Hiel, H., Kong, J. H., Yi, E., Glowatzki, E., and Lustig, L. R. (2006) Progressive Deafness and Altered Cochlear Innervation in Knock-Out Mice Lacking Prosaposin. J Neurosci. 26, 13076-13088.
38. Sun, Y., Witte, D. P., Ran, H., Zamzow, M., Barnes, S., Cheng, H., Han, X., Williams, M. T., Skelton, M. R., Vorhees, C. V., and Grabowski, G. A. (2008) Neurological Deficits and Glycosphingolipid Accumulation in Saposin B Deficient Mice. Hum Mol Genet. 17, 2345-2356.
39. Sun, Y., Zamzow, M., Ran, H., Zhang, W., Quinn, B., Barnes, S., Witte, D. P., Setchell, K. D., Williams, M. T., Vorhees, C. V., and Grabowski, G. A. (2013) Tissue-Specific Effects of Saposin A and Saposin B on Glycosphingolipid Degradation in Mutant Mice. Hum Mol Genet. 22, 2435-2450.
40. Sun, Y., Liou, B., Ran, H., Skelton, M. R., Williams, M. T., Vorhees, C. V., Kitatani, K., Hannun, Y. A., Witte, D. P., Xu, Y. H., and Grabowski, G. A. (2010) Neuronopathic Gaucher Disease in the Mouse: Viable Combined Selective Saposin C Deficiency and Mutant Glucocerebrosidase (V394L) Mice with Glucosylsphingosine and Glucosylceramide Accumulation and Progressive Neurological Deficits. Hum Mol Genet. 19, 1088-1097.
41. Matsuda, J., Vanier, M. T., Saito, Y., Tohyama, J., Suzuki, K., and Suzuki, K. (2001) A Mutation in the Saposin A Domain of the Sphingolipid Activator Protein (Prosaposin) Gene Results in a Late-Onset, Chronic Form of Globoid Cell Leukodystrophy in the Mouse. Hum Mol Genet. 10, 1191-1199.
42. Sun, Y., Ran, H., Zamzow, M., Kitatani, K., Skelton, M. R., Williams, M. T., Vorhees, C. V., Witte, D. P., Hannun, Y. A., and Grabowski, G. A. (2010) Specific Saposin C Deficiency: CNS Impairment and Acid Beta-Glucosidase Effects in the Mouse. Hum Mol Genet. 19, 634-647.
43. Matsuda, J., Kido, M., Tadano-Aritomi, K., Ishizuka, I., Tominaga, K., Toida, K., Takeda, E., Suzuki, K., and Kuroda, Y. (2004) Mutation in Saposin D Domain of Sphingolipid Activator Protein Gene Causes Urinary System Defects and Cerebellar Purkinje Cell Degeneration with Accumulation of Hydroxy Fatty Acid-Containing Ceramide in Mouse. Hum Mol Genet. 13, 2709-2723.
44. Sun, Y., Witte, D. P., Zamzow, M., Ran, H., Quinn, B., Matsuda, J., and Grabowski, G. A. (2007) Combined Saposin C and D Deficiencies in Mice Lead to a Neuronopathic Phenotype, Glucosylceramide and Alpha-Hydroxy Ceramide Accumulation, and Altered Prosaposin Trafficking. Hum Mol Genet. 16, 957-971.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Lauren Prince, Sara Ludwig, Jamie Russell, and Bruce Beutler |