Incidental Mutation 'R4666:Psap'
ID 351946
Institutional Source Beutler Lab
Gene Symbol Psap
Ensembl Gene ENSMUSG00000004207
Gene Name prosaposin
Synonyms SGP-1
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 60113449-60138376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60136324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 486 (D486G)
Ref Sequence ENSEMBL: ENSMUSP00000137476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000165878] [ENSMUST00000105465] [ENSMUST00000177779] [ENSMUST00000179238]
AlphaFold Q61207
Predicted Effect probably benign
Transcript: ENSMUST00000004316
AA Change: D485G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: D485G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073242
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105464
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165878
AA Change: D480G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207
AA Change: D480G

DomainStartEndE-ValueType
SAPA 18 51 1.4e-18 SMART
SapB 58 135 1.87e-27 SMART
SapB 192 267 2.76e-16 SMART
SapB 309 384 2.07e-20 SMART
low complexity region 407 425 N/A INTRINSIC
SapB 434 509 3.84e-24 SMART
SAPA 518 551 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105465
AA Change: D483G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: D483G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177779
AA Change: D486G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: D486G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179238
AA Change: D486G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: D486G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Psap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Psap APN 10 60,128,316 (GRCm39) missense probably damaging 1.00
IGL01100:Psap APN 10 60,135,708 (GRCm39) missense probably benign 0.03
IGL01122:Psap APN 10 60,135,253 (GRCm39) missense probably benign 0.04
IGL02544:Psap APN 10 60,136,405 (GRCm39) splice site probably benign
twerk UTSW 10 60,136,630 (GRCm39) missense probably damaging 1.00
R0591:Psap UTSW 10 60,136,634 (GRCm39) missense possibly damaging 0.65
R0624:Psap UTSW 10 60,135,345 (GRCm39) splice site probably benign
R1018:Psap UTSW 10 60,136,590 (GRCm39) missense probably damaging 1.00
R1896:Psap UTSW 10 60,130,826 (GRCm39) nonsense probably null
R3161:Psap UTSW 10 60,113,575 (GRCm39) missense possibly damaging 0.95
R3162:Psap UTSW 10 60,113,575 (GRCm39) missense possibly damaging 0.95
R3162:Psap UTSW 10 60,113,575 (GRCm39) missense possibly damaging 0.95
R3615:Psap UTSW 10 60,130,383 (GRCm39) missense probably benign 0.06
R3616:Psap UTSW 10 60,130,383 (GRCm39) missense probably benign 0.06
R4622:Psap UTSW 10 60,136,630 (GRCm39) missense probably damaging 1.00
R4623:Psap UTSW 10 60,136,630 (GRCm39) missense probably damaging 1.00
R5131:Psap UTSW 10 60,135,736 (GRCm39) missense possibly damaging 0.72
R5203:Psap UTSW 10 60,130,755 (GRCm39) missense probably damaging 1.00
R5251:Psap UTSW 10 60,137,479 (GRCm39) missense probably damaging 0.99
R5511:Psap UTSW 10 60,134,959 (GRCm39) missense possibly damaging 0.51
R5764:Psap UTSW 10 60,129,186 (GRCm39) missense probably benign 0.18
R6207:Psap UTSW 10 60,136,317 (GRCm39) missense probably damaging 1.00
R7003:Psap UTSW 10 60,135,276 (GRCm39) missense probably damaging 1.00
R7494:Psap UTSW 10 60,135,275 (GRCm39) missense probably benign 0.00
R7525:Psap UTSW 10 60,135,253 (GRCm39) missense probably benign 0.04
R7711:Psap UTSW 10 60,135,634 (GRCm39) missense probably damaging 0.96
R8252:Psap UTSW 10 60,113,511 (GRCm39) start gained probably benign
R8894:Psap UTSW 10 60,135,736 (GRCm39) missense possibly damaging 0.72
R9062:Psap UTSW 10 60,131,738 (GRCm39) missense possibly damaging 0.49
R9756:Psap UTSW 10 60,130,784 (GRCm39) missense possibly damaging 0.70
X0019:Psap UTSW 10 60,135,694 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGTGTCCGTTCACTGCTAATG -3'
(R):5'- TTCAGAGCTGAGACCGAAGC -3'

Sequencing Primer
(F):5'- CACTGCTAATGTTCCAGTGTG -3'
(R):5'- GAGCTGAGACCGAAGCACTTC -3'
Posted On 2015-10-08