Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Psap'

268405

Institutional Source

Beutler Lab

Gene Symbol

Psap

Ensembl Gene

ENSMUSG00000004207

Gene Name

prosaposin

Synonyms

SGP-1

MMRRC Submission

040673-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60277627-60302597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60294603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 149 (N149S)

Ref Sequence

ENSEMBL: ENSMUSP00000137286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]

AlphaFold

Q61207

Predicted Effect

probably benign
Transcript: ENSMUST00000004316
AA Change: N149S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: N149S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	272	1.2e-16	SMART
SapB	314	389	2.07e-20	SMART
low complexity region	412	430	N/A	INTRINSIC
SapB	439	514	3.84e-24	SMART
SAPA	523	556	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105465
AA Change: N149S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: N149S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	270	2.76e-16	SMART
SapB	312	387	2.07e-20	SMART
low complexity region	410	428	N/A	INTRINSIC
SapB	437	512	3.84e-24	SMART
SAPA	521	554	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165878
AA Change: N146S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207
AA Change: N146S

Domain	Start	End	E-Value	Type
SAPA	18	51	1.4e-18	SMART
SapB	58	135	1.87e-27	SMART
SapB	192	267	2.76e-16	SMART
SapB	309	384	2.07e-20	SMART
low complexity region	407	425	N/A	INTRINSIC
SapB	434	509	3.84e-24	SMART
SAPA	518	551	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177779
AA Change: N149S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: N149S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	2.37e-15	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179238
AA Change: N149S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: N149S

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	8.5e-17	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Meta Mutation Damage Score

0.0595

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Psap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Psap	APN	10	60292536	missense	probably damaging	1.00
IGL01100:Psap	APN	10	60299929	missense	probably benign	0.03
IGL01122:Psap	APN	10	60299474	missense	probably benign	0.04
IGL02544:Psap	APN	10	60300626	splice site	probably benign
twerk	UTSW	10	60300851	missense	probably damaging	1.00
R0591:Psap	UTSW	10	60300855	missense	possibly damaging	0.65
R0624:Psap	UTSW	10	60299566	splice site	probably benign
R1018:Psap	UTSW	10	60300811	missense	probably damaging	1.00
R1896:Psap	UTSW	10	60295046	nonsense	probably null
R3161:Psap	UTSW	10	60277753	missense	possibly damaging	0.95
R3162:Psap	UTSW	10	60277753	missense	possibly damaging	0.95
R3162:Psap	UTSW	10	60277753	missense	possibly damaging	0.95
R3615:Psap	UTSW	10	60294603	missense	probably benign	0.06
R4622:Psap	UTSW	10	60300851	missense	probably damaging	1.00
R4623:Psap	UTSW	10	60300851	missense	probably damaging	1.00
R4666:Psap	UTSW	10	60300545	missense	probably benign
R5131:Psap	UTSW	10	60299957	missense	possibly damaging	0.72
R5203:Psap	UTSW	10	60294975	missense	probably damaging	1.00
R5251:Psap	UTSW	10	60301700	missense	probably damaging	0.99
R5511:Psap	UTSW	10	60299180	missense	possibly damaging	0.51
R5764:Psap	UTSW	10	60293406	missense	probably benign	0.18
R6207:Psap	UTSW	10	60300538	missense	probably damaging	1.00
R7003:Psap	UTSW	10	60299497	missense	probably damaging	1.00
R7494:Psap	UTSW	10	60299496	missense	probably benign	0.00
R7525:Psap	UTSW	10	60299474	missense	probably benign	0.04
R7711:Psap	UTSW	10	60299855	missense	probably damaging	0.96
R8252:Psap	UTSW	10	60277689	start gained	probably benign
R8894:Psap	UTSW	10	60299957	missense	possibly damaging	0.72
R9062:Psap	UTSW	10	60295958	missense	possibly damaging	0.49
R9756:Psap	UTSW	10	60295004	missense	possibly damaging	0.70
X0019:Psap	UTSW	10	60299915	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAGCCTGCAGGTTAGACAC -3'
(R):5'- AAGGGAGAGCCTGTGTTCTG -3'

Sequencing Primer
(F):5'- ACCTGGTGTGCAACTTCCTAATC -3'
(R):5'- AGAGCCTGTGTTCTGTCCAGC -3'

Posted On

2015-02-19