Phenotypic Mutation 'numb'

• Allele: numb
• Mutation Type: splice site
• Chromosome: 10
• Coordinate: 128,116,934 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Stat2
• Gene Name: signal transducer and activator of transcription 2
• Synonym(s): 1600010G07Rik
• Chromosomal Location: 128,106,428-128,128,718 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] ; PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000082855 ^†] [ENSMUSP00000100872 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000082855; Gene: ENSMUSG00000040033

Domain	Start	End	E-Value	Type
STAT_int	2	124	4.49e-54	SMART
Pfam:STAT_alpha	138	314	5e-52	PFAM
Pfam:STAT_bind	316	564	1.2e-96	PFAM
SH2	576	652	4.71e-6	SMART
internal_repeat_1	750	778	6.35e-10	PROSPERO
internal_repeat_1	822	850	6.35e-10	PROSPERO
Pfam:STAT2_C	853	907	1.1e-28	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000100872; Gene: ENSMUSG00000040033

Domain	Start	End	E-Value	Type
STAT_int	2	124	4.49e-54	SMART
Pfam:STAT_alpha	141	314	2.6e-49	PFAM
Pfam:STAT_bind	316	564	1.5e-67	PFAM
SH2	577	653	4.71e-6	SMART
internal_repeat_1	751	779	6.69e-10	PROSPERO
internal_repeat_1	823	851	6.69e-10	PROSPERO
Pfam:STAT2_C	854	908	1.7e-27	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.209)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Diantha La Vine
• Record Created: 2017-06-22 1:28 PM by Bruce Beutler
• Record Posted: 2018-09-07
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_019963; MGI:103039

Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(1) Gene trapped(6) Targeted(2)

Phenotypic Description

Figure 1. Numb mice exhibit decreased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Numb mice exhibit decreased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The numb phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5264, some of which showed reduced frequencies of CD44+ CD8 T cells (Figure 1) and central memory CD8 T cells in CD8 T cells (Figure 2) in the peripheral blood.

Nature of Mutation

Figure 3. Linkage mapping of the reduced CD44+ CD8 T cell phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R5264. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Stat2:  a T to A transversion at base pair 128,281,065  (v38) on chromosome 10, or base pair 10,507 in the GenBank genomic region NC_000076 within intron 8 (17 base pairs from exon 9).  The strongest association was found with a recessive model of inheritance to the normalized frequency of CD44+ CD8 T cells, wherein six variant homozygotes departed phenotypically from 12 homozygous reference mice and 32 heterozygous mice with a P value of 4.248 x 10^-6 (Figure 3).  

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in usage of a cryptic site in intron 8. The resulting transcript would have a 15-base pair insertion of intron 8, and would cause a predicted in-frame insertion of five aberrant amino acids after amino acid 261 of the protein.

C57BL/6J:

<--exon 7     <--exon 8            <--intron 8 exon 9-->           <--exon 24 7801 ……AGAATGAGAAAG ……CTGGAACAGTG ……ccctggactctgttacccag GTTGACGGCTGGA…… ……GATACCTTCTGA…… 20815 207  ……-R--M--R--K- ……-L--E--Q--W                        --L--T--A--G-…… ……-D--T--F--*-   922

The acceptor splice site of intron 8 is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 4. Domain structure of the STAT2 protein. CC=Coiled Coil domain; DBD = DNA binding domain; LD = Linker domain; SH2=Src Homology 2 domain; TAD = Transcriptional activation domain. The numb mutation occurs in intron 8.

Figure 5. Crystal structure of unphosphorylated dimeric STAT1. The N-terminal domains are in pink, the coiled-coil regions are in purple, the DNA-binding domains are in blue, the linker domains are in yellow, and the SH2 domains are in cyan. The transactivation domains are not shown. UCSF Chimera model is based on PDB 1YVL, Mao et al., Mol. Cell. 17, 761-771 (2005). Click on the 3D structure to view it rotate.

Signal transducer and activator of transcription (STAT)-2 is one of seven STAT family members identified in mammals (see the record for domino for more information about Stat1). STAT2 is a 923 amino acid protein, and like all STATs, contains an N-terminal helical domain (N-domain), a four helix bundle, a central Ig-like DNA binding domain, a helical linker domain, an SH2 domain, and a C-terminal transactivation domain (TAD) (Figure 4) (1).

The crystal structure of the core protein fragment (residues 132-713, excluding the N-domain and the C-terminal TAD) of the tyrosine phosphorylated human STAT1 dimer bound to DNA has been solved, as well as that of the unphosphorylated protein (residues 1-683) complexed with an IFN-γ-derived phosphopeptide, revealing some of the functions of the domains (Figure 5) (2;3). The four helix bundle forms a coiled-coil structure projecting outward from the DNA binding domain, and presents a predominantly hydrophilic surface area that likely mediates heterotypic protein-protein interactions (2). The DNA binding domain contains several β-sheets folded in a manner similar to the DNA binding domains of NF-κB or p53; these β-sheets are connected by loops that make contact with both the major and minor grooves of bound DNA (2). The linker domain has a highly conserved structure, but its function is unknown. The SH2 domain mediates dimerization of two STAT1 molecules via reciprocal binding to phosphorylated tyrosine 701 between the two monomers (2). No other protein contacts were observed in the phosphorylated DNA-bound dimer.

The N-domain serves at least two functions. Based on the crystal structure of the similar STAT4 amino terminus (residues 1-130), the N-domain is thought to allow STAT tetramer formation (4;5). Many genes contain tandem STAT binding sites approximately 20 amino acids apart, which are occupied by STAT tetramers (dimer-dimer pairs). Tetramer formation strengthens STAT-DNA interactions (6), and is necessary for optimal transcriptional activation of some promoters (7). In addition to this function, the N-domain is also reported to mediate antiparallel dimer formation of unphosphorylated STAT1 molecules prior to activation (3). N-domain interactions appear to stabilize interactions between the core protein fragments. Crystallographic studies of the mouse STAT5a core fragment (lacking the N-domain and TAD domain) support such N-domain interactions. STAT5a dimerizes in an antiparallel fashion similar to unphosphorylated STAT1, and FRET measurements demonstrate that STAT5a N-domains separate after activation and nuclear translocation (8).

The C-terminal TAD in all STATs is relatively acidic and proline-rich, and is therefore structurally flexible. The TAD is thought to mediate interactions of STATs with other transcriptional machinery. The TAD also contains a serine residue, conserved in a subset of STATs, which must be phosphorylated full STAT activation (9;10).

The numb mutation is predicted to result in an in-frame insertion of five aberrant amino acids after amino acid 261 of the protein; amino acid 261 is within the four-helix bundle.

Expression/Localization

Stat2 is detectable by RT-PCR in most tissues examined. The protein is cytosolic until activation results in its translocation to the nucleus.

Background

Figure 6. JAK-STAT Pathway. Cytokine receptors are associated with the normally dephosphorylated and inactive JAK tyrosine kinases. Latent STAT1 exists in the cytoplasm as a monomer. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.

Figure 7. Diagram of the type I interferon receptor complex composed of IFNAR1 and IFNAR2 and type I IFN signaling pathways. The extracellular regions of the IFNAR receptor subunits consist of Fibronectin III domains, which are labeled as subdomain (SD) 1-4 in IFNAR1. The intracelluar regions of the IFNAR receptor subunits can interact with several factors that are important from type I IFN signaling. IFNAR1 and 2 contain proline-rich regions that bind to JAK tyrosine kinases (TYK2 binds to IFNAR1 and JAK1 binds to IFNAR2.) Phosphorylation of the IFNAR intracellular domains by these kinases leads to the activation of STATs, which are then able to form homo- and heterodimeric complexes. The interaction of SOCS1 with IFNAR1 inhibits STAT activation, while UBP43 binds to the JAK1 binding site. The STAT1/STAT2 heterodimer forms the ISGF3 complex with IRF9 that translocates into the nucleus where it activates genes containing the IFN-stimulated response element (ISRE). STAT1/STAT1 homodimers can activate genes containing the IFN-γ-activated sequence (GAS). The JAK kinases also activate other substrates, which initiate many pathways. For example, phosyphorylation of insulin receptor substrate (IRS) proteins leads to PI3K activation, wh ich has multiple downstream effectors. Phosphorylation of guanine nucleotide exchange factor (VAV) leads to activation of the small G protein, RAC1, which in turn activates MAP kinase pathways leading to p38 activation. Other factors that are activated in response to type I IFNs include the transcription factor NF-κB, which is downstream of PI3k or TRAF2, and AP1, which is activated by the ERK pathway. Please see text for further details. This image is interactive. Click on the image to view mutations within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The STAT proteins serve the dual functions of signal transduction and activation of transcription. The STAT proteins are transcription factors found latent in the cytoplasm until they are activated by extracellular signaling proteins such as cytokines, growth factors, and peptides. Stimulation by these extracellular signaling proteins leads to activation of intracellular tyrosine kinases that in turn phosphorylate STATs, causing them to move into the nucleus and activate transcription of target genes. STAT2 is a subunit of ISGF3, a multi-protein (STAT1, STAT2, and p48) transcription factor that is activated in the cytoplasm after attachment of interferon-alpha to the cell surface (1). Formation of the ISGF3 complex is considered a hallmark of type I and III IFN activation.

The canonical signaling pathway activating STAT proteins, called the JAK (Janus kinase)-STAT pathway (Figure 6), begins with the binding of one or more cytokines to their cognate cell-surface receptors. These receptors are associated with JAK tyrosine kinases, which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins. Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. 

STAT2 functions downstream of the type I IFN receptor (see the entries for macro-1 [Ifnar1] and macro-2 [Ifnar2]) (Figure 7). Type I IFNs are a critical class of cytokines that have potent antiviral, growth-inhibitory and immunomodulatory functions [reviewed in (11;12)]. The production of type I IFNs in response to viral infection leads to inhibition of viral propagation and increases the vulnerability of infected cells to virus-induced apoptosis (13), a mechanism that is suggested to limit viral spread and may also increase the delivery of antigen to professional antigen-presenting cells (APCs) and be important to the onset of adaptive immunity. Type I IFNs activate natural killer (NK) cells, macrophages and dendritic cells (DCs), all of which play an essential role in the innate immune system (14;15).  In addition to their antiviral effects, type I IFNs are also produced in response to infection with bacterial pathogens and have an important role in the host response to bacterial infection [reviewed by (16)]. 

Type I IFN signaling modulates the expression of hundreds of IFN-stimulated genes (ISGs), accounting for the diverse biological properties of these cytokines and their highly pleiotropic and diverse effects. Type I IFNs induce ISGs by activating several signal transduction pathways including the classical JAK/STAT signaling pathway. The IFNAR1 subunit of the IFNAR associates with the protein tyrosine kinase TYK2, and the IFNAR2 subunit associates with the protein tyrosine kinase JAK1. Binding of ligand to the IFNAR complex results in conformational changes that juxtapose these protein tyrosine kinases, resulting in auto and cross-phosphorylation and activation [reviewed by (17;18)].  Phosphorylation of critical tyrosine residues on the IFNAR receptor results in recruitment of signal transducing molecules such as STAT1 and STAT2 to the complex (19-21). Phosphorylation of these signal-transducing molecules by the IFNAR-associated protein kinases results in formation of STAT1/STAT2 heterodimers and STAT1 homodimers that dissociate from the receptor and translocate into the nucleus to form transcriptional complexes with other factors.  STAT1/STAT2 heterodimers, along with IRF-9, forms the IFN-stimulated gene factor 3 (ISGF3) complex that binds to upstream regulatory consensus sequences (IFN-stimulated response elements or ISRE) of type I IFN-inducible genes to initiate transcription.  ISGF3 regulates the transcription of IRF-7 (22;23), providing the type I IFN system a positive feedback loop that allows massive amplification of the type I IFN response.  STAT1 homodimers stimulate the transcription of genes containing the IFN-γ-activated sequence (GAS) (24). 

Mutations in STAT2 are linked to immunodeficiency 44 (IMD44; OMIM: #616636) (25;26). Patients with IMD44 exhibited increased susceptibility to viral infection as well as failure of the type I interferon response. Patients with IMD44 also exhibit defects in mitochondrial fission and fusion (26).

Putative Mechanism

A mouse model homozygous for an ENU-induced Stat2 allele reduced numbers of dendritic cells (cDCs and pDCs) in the spleen, increased susceptibility to encephalomyocarditis, and lower TLR ligand-induced MHC class II levels on pDCs; basal levels are not different (27). Stat2-deficient mice exhibited a substantial repopulation of the CD4/CD8 double-positive compartment after a dexamethasone challenge; wild-type mice only showed an increased in their CD8+ population (28). The Stat2-deficient mice also showed increased susceptibility to viral infection. The phenotype of the numb mice indicates loss of STAT2-associated function.

Primers

PCR Primer
numb_pcr_F: AGTGCTCTGCCATATGCTTC
numb_pcr_R: CTACAGACCTTTGGAGCAGACG

Sequencing Primer
numb_seq_F: GGCTGACCTTGAACTCAGTCTATAG
numb_seq_R: GACGCTGAAGTAACTCCATGACTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 647 nucleotides is amplified (chromosome 10, + strand):

1   agtgctctgc catatgcttc ctggattctg tttgtttgtg gcaggggtct cttgtgtccc
61  aggctgacct tgaactcagt ctatagctga aaatgaatga gtcttcttgc tttcgcctcc
121 tcagagtttg aatttccggt gtataatccc tgtgcctagt tgatgcagtg ttggagatca
181 gatctaggaa tttgtacctg ttctaccaaa ggagctacat caataacctt gcgtttactt
241 ttacttattt ttaagactgg atcacagtaa ataacccagg ctagccttga actcacaaca
301 ctcctacttc aaccttgaga gtctggggat cacaaggatg aaatcacaca cctggctccg
361 agctcttttt agctcaagtc agtttccaac tctctacact attaaagaga ggacactcaa
421 gagcctcagt ggggccccag aaaacttaca cattctctct ccctggactc tgttacccag
481 gttgacggct ggagcaaagt tcttgttcca ccttcggcag ctactgaagc agctgaagga
541 gatgagtcac atgcttcggt ataagggtga catgtttggc caaggggtgg acctgcagaa
601 tgcccaagtc atggagttac ttcagcgtct gctccaaagg tctgtag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Fu, X. Y., Schindler, C., Improta, T., Aebersold, R., and Darnell, J. E.,Jr. (1992) The Proteins of ISGF-3, the Interferon Alpha-Induced Transcriptional Activator, Define a Gene Family Involved in Signal Transduction. Proc Natl Acad Sci U S A. 89, 7840-7843.

  2. Chen, X., Vinkemeier, U., Zhao, Y., Jeruzalmi, D., Darnell, J. E.,Jr., and Kuriyan, J. (1998) Crystal Structure of a Tyrosine Phosphorylated STAT-1 Dimer Bound to DNA. Cell. 93, 827-839.

  3. Mao, X., Ren, Z., Parker, G. N., Sondermann, H., Pastorello, M. A., Wang, W., McMurray, J. S., Demeler, B., Darnell, J. E.,Jr., and Chen, X. (2005) Structural Bases of Unphosphorylated STAT1 Association and Receptor Binding. Mol Cell. 17, 761-771.

  4. Vinkemeier, U., Moarefi, I., Darnell, J. E.,Jr., and Kuriyan, J. (1998) Structure of the Amino-Terminal Protein Interaction Domain of STAT-4. Science. 279, 1048-1052.

  5. Xu, X., Sun, Y. L., and Hoey, T. (1996) Cooperative DNA Binding and Sequence-Selective Recognition Conferred by the STAT Amino-Terminal Domain. Science. 273, 794-797.

  6. Vinkemeier, U., Cohen, S. L., Moarefi, I., Chait, B. T., Kuriyan, J., and Darnell, J. E.,Jr. (1996) DNA Binding of in Vitro Activated Stat1 Alpha, Stat1 Beta and Truncated Stat1: Interaction between NH2-Terminal Domains Stabilizes Binding of Two Dimers to Tandem DNA Sites. EMBO J. 15, 5616-5626.

  7. John, S., Vinkemeier, U., Soldaini, E., Darnell, J. E.,Jr., and Leonard, W. J. (1999) The Significance of Tetramerization in Promoter Recruitment by Stat5. Mol Cell Biol. 19, 1910-1918.

  8. Neculai, D., Neculai, A. M., Verrier, S., Straub, K., Klumpp, K., Pfitzner, E., and Becker, S. (2005) Structure of the Unphosphorylated STAT5a Dimer. J Biol Chem. 280, 40782-40787.

  9. Wen, Z., Zhong, Z., and Darnell, J. E.,Jr. (1995) Maximal Activation of Transcription by Stat1 and Stat3 Requires both Tyrosine and Serine Phosphorylation. Cell. 82, 241-250.

  10. Pilz, A., Ramsauer, K., Heidari, H., Leitges, M., Kovarik, P., and Decker, T. (2003) Phosphorylation of the Stat1 Transactivating Domain is Required for the Response to Type I Interferons. EMBO Rep. 4, 368-373.

   11.  Pestka, S., Krause, C. D., and Walter, M. R. (2004) Interferons, interferon-like cytokines, and their receptors, Immunol. Rev. 202, 8-32.

 12.  van Boxel-Dezaire, A. H., Rani, M. R., and Stark, G. R. (2006) Complex modulation of cell type-specific signaling in response to type I interferons, Immunity 25, 361-372.

 13.  Tanaka, N., Sato, M., Lamphier, M. S., Nozawa, H., Oda, E., Noguchi, S., Schreiber, R. D., Tsujimoto, Y., and Taniguchi, T. (1998) Type I interferons are essential mediators of apoptotic death in virally infected cells, Genes Cells 3, 29-37.

 14.  Pestka, S., Langer, J. A., Zoon, K. C., and Samuel, C. E. (1987) Interferons and their actions, Annu. Rev. Biochem. 56, 727-777.

 15.  Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P., and Salazar-Mather, T. P. (1999) Natural killer cells in antiviral defense: function and regulation by innate cytokines, Annu. Rev. Immunol. 17, 189-220.

 16.  Decker, T., Muller, M., and Stockinger, S. (2005) The yin and yang of type I interferon activity in bacterial infection, Nat. Rev. Immunol. 5, 675-687.

 17.  Takaoka, A. and Yanai, H. (2006) Interferon signalling network in innate defence, Cell Microbiol. 8, 907-922.

 18.  Theofilopoulos, A. N., Baccala, R., Beutler, B., and Kono, D. H. (2005) Type I Interferons (a/b) in Immunity and Autoimmunity, Annu. Rev. Immunol.

 19.  Zhao, W., Lee, C., Piganis, R., Plumlee, C., de, W. N., Hertzog, P. J., and Schindler, C. (2008) A conserved IFN-alpha receptor tyrosine motif directs the biological response to type I IFNs, J Immunol. 180, 5483-5489.

 20.  Yan, H., Krishnan, K., Greenlund, A. C., Gupta, S., Lim, J. T., Schreiber, R. D., Schindler, C. W., and Krolewski, J. J. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein, EMBO J 15, 1064-1074.

 21.  Li, X., Leung, S., Kerr, I. M., and Stark, G. R. (1997) Functional subdomains of STAT2 required for preassociation with the alpha interferon receptor and for signaling, Mol. Cell Biol. 17, 2048-2056.

 22.  Marie, I., Durbin, J. E., and Levy, D. E. (1998) Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7, EMBO J 17, 6660-6669.

 23.  Sato, M., Hata, N., Asagiri, M., Nakaya, T., Taniguchi, T., and Tanaka, N. (1998) Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7, FEBS Lett 441, 106-110.

 24.  Decker, T., Lew, D. J., and Darnell, J. E., Jr. (1991) Two distinct alpha-interferon-dependent signal transduction pathways may contribute to activation of transcription of the guanylate-binding protein gene, Mol. Cell Biol. 11, 5147-5153.

  25. Hambleton, S., Goodbourn, S., Young, D. F., Dickinson, P., Mohamad, S. M., Valappil, M., McGovern, N., Cant, A. J., Hackett, S. J., Ghazal, P., Morgan, N. V., and Randall, R. E. (2013) STAT2 Deficiency and Susceptibility to Viral Illness in Humans. Proc Natl Acad Sci U S A. 110, 3053-3058.

  26. Shahni, R., Cale, C. M., Anderson, G., Osellame, L. D., Hambleton, S., Jacques, T. S., Wedatilake, Y., Taanman, J. W., Chan, E., Qasim, W., Plagnol, V., Chalasani, A., Duchen, M. R., Gilmour, K. C., and Rahman, S. (2015) Signal Transducer and Activator of Transcription 2 Deficiency is a Novel Disorder of Mitochondrial Fission. Brain. 138, 2834-2846.

  27. Chen, L. S., Wei, P. C., Liu, T., Kao, C. H., Pai, L. M., and Lee, C. K. (2009) STAT2 Hypomorphic Mutant Mice Display Impaired Dendritic Cell Development and Antiviral Response. J Biomed Sci. 16, 22-0127-16-22.

  28. Park, C., Li, S., Cha, E., and Schindler, C. (2000) Immune Response in Stat2 Knockout Mice. Immunity. 13, 795-804.