Mutagenetix > Incidental Mutation

Incidental Mutation 'R6752:Stat2'

530841

Institutional Source

Beutler Lab

Gene Symbol

Stat2

Ensembl Gene

ENSMUSG00000040033

Gene Name

signal transducer and activator of transcription 2

Synonyms

1600010G07Rik

MMRRC Submission

Accession Numbers

Genbank: NM_019963.1; Ensembl: ENSMUST00000085708

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R6752 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128270559-128292849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128283753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 503 (F503L)

Ref Sequence

ENSEMBL: ENSMUSP00000100872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000085708
AA Change: F502L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033
AA Change: F502L

Domain	Start	End	E-Value	Type
STAT_int	2	124	4.49e-54	SMART
Pfam:STAT_alpha	138	314	5e-52	PFAM
Pfam:STAT_bind	316	564	1.2e-96	PFAM
SH2	576	652	4.71e-6	SMART
internal_repeat_1	750	778	6.35e-10	PROSPERO
internal_repeat_1	822	850	6.35e-10	PROSPERO
Pfam:STAT2_C	853	907	1.1e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105238
AA Change: F503L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033
AA Change: F503L

Domain	Start	End	E-Value	Type
STAT_int	2	124	4.49e-54	SMART
Pfam:STAT_alpha	141	314	2.6e-49	PFAM
Pfam:STAT_bind	316	564	1.5e-67	PFAM
SH2	577	653	4.71e-6	SMART
internal_repeat_1	751	779	6.69e-10	PROSPERO
internal_repeat_1	823	851	6.69e-10	PROSPERO
Pfam:STAT2_C	854	908	1.7e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217727

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217852

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218862

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220142

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220277

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,195,483	L45S	probably benign	Het
Agbl2	G	A	2: 90,803,074	C518Y	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Aox1	T	C	1: 58,047,239	I101T	probably benign	Het
Arhgap23	T	C	11: 97,452,248	F241S	probably damaging	Het
Asmt	A	G	X: 170,676,361	M202V	probably benign	Het
Atp6v0a2	A	G	5: 124,641,514	E189G	probably damaging	Het
Birc3	G	A	9: 7,857,344	A376V	probably benign	Het
Ccbe1	C	T	18: 66,076,307		probably null	Het
Chst2	C	A	9: 95,404,749	E515*	probably null	Het
Col12a1	A	T	9: 79,633,424	N2426K	possibly damaging	Het
Dmrt2	A	G	19: 25,678,342	N435S	probably damaging	Het
Dnah14	A	G	1: 181,593,452	K123E	probably benign	Het
Dock4	T	A	12: 40,820,617	L1452Q	probably damaging	Het
Galnt7	G	A	8: 57,652,951	R10C	probably damaging	Het
Gm16506	A	G	14: 43,727,419	I22T	unknown	Het
H2-Q6	A	G	17: 35,428,127	T292A	probably damaging	Het
Ifne	A	G	4: 88,880,082	M33T	probably benign	Het
Igf2r	G	A	17: 12,714,944	R808W	probably damaging	Het
Igfbp5	T	C	1: 72,863,909	E169G	probably damaging	Het
Inppl1	G	A	7: 101,832,542	R198*	probably null	Het
Irgm1	T	C	11: 48,866,463	T174A	probably damaging	Het
Itih3	C	T	14: 30,923,489	G21S	possibly damaging	Het
Klra4	G	T	6: 130,062,028	Q134K	probably benign	Het
Mfsd1	T	A	3: 67,596,603	Y309*	probably null	Het
Mrps10	A	G	17: 47,377,815	N162S	probably damaging	Het
Mtmr14	T	C	6: 113,240,397	F90S	probably damaging	Het
Myh15	A	G	16: 49,182,927	D1783G	probably damaging	Het
Myo3b	A	G	2: 70,289,512	E972G	probably damaging	Het
Myt1	G	T	2: 181,801,082	V455F	probably damaging	Het
Nbea	T	A	3: 55,968,309	T1647S	probably benign	Het
Nbea	A	T	3: 56,037,219	S575T	probably benign	Het
Ntn4	A	G	10: 93,734,175	N466S	probably benign	Het
Olfr1113	A	G	2: 87,213,044	M51V	probably benign	Het
Olfr1468-ps1	T	A	19: 13,375,526	L188H	unknown	Het
Olfr197	T	A	16: 59,186,331	N51Y	probably damaging	Het
Pcdhgb4	T	A	18: 37,720,651	I33N	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pom121l2	T	G	13: 21,981,769	F70C	probably damaging	Het
Psmb5	T	C	14: 54,616,755	T89A	probably benign	Het
Rab11fip2	T	C	19: 59,907,043	D471G	probably damaging	Het
Rnh1	A	G	7: 141,163,441	V207A	probably benign	Het
Sh3tc2	C	A	18: 61,961,037	T49N	probably benign	Het
Skint4	T	C	4: 112,119,863	M158T	possibly damaging	Het
Skint7	T	A	4: 111,980,266	H80Q	probably benign	Het
Smg1	A	G	7: 118,163,316		probably benign	Het
Sostdc1	T	C	12: 36,314,412	V40A	probably benign	Het
Sptlc1	C	A	13: 53,335,358	K437N	possibly damaging	Het
Syt16	A	T	12: 74,229,213		probably null	Het
Tspyl1	T	C	10: 34,282,587	S103P	probably benign	Het
Ube4a	A	T	9: 44,925,948	S1053R	probably damaging	Het
Vipr1	A	G	9: 121,653,893	N58S	probably damaging	Het
Zfp184	C	A	13: 21,959,408	A428E	probably damaging	Het
Zfp292	A	C	4: 34,808,593	F1484V	possibly damaging	Het
Zfp599	G	A	9: 22,249,544	H442Y	probably damaging	Het
Zfp944	G	A	17: 22,339,519	T249I	probably benign	Het
Zkscan14	T	A	5: 145,195,506	H405L	probably damaging	Het

Other mutations in Stat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01833:Stat2	APN	10	128281176	missense	probably benign	0.42
IGL02528:Stat2	APN	10	128290665	missense	probably benign	0.07
IGL02859:Stat2	APN	10	128276611	missense	probably damaging	1.00
IGL03119:Stat2	APN	10	128283517	missense	probably benign	0.15
numb	UTSW	10	128281065	splice site	probably null
Paresthetic	UTSW	10	128281242	critical splice donor site	probably null
1mM(1):Stat2	UTSW	10	128277723	missense	probably benign	0.06
R0098:Stat2	UTSW	10	128283262	missense	probably damaging	1.00
R0334:Stat2	UTSW	10	128277867	missense	probably damaging	1.00
R0496:Stat2	UTSW	10	128276509	missense	probably benign	0.04
R1478:Stat2	UTSW	10	128282100	critical splice acceptor site	probably null
R2857:Stat2	UTSW	10	128276901	splice site	probably null
R3698:Stat2	UTSW	10	128278793	missense	probably benign	0.30
R3870:Stat2	UTSW	10	128277893	missense	probably benign	0.17
R5231:Stat2	UTSW	10	128281242	critical splice donor site	probably null
R5235:Stat2	UTSW	10	128291032	critical splice donor site	probably null
R5264:Stat2	UTSW	10	128281065	splice site	probably null
R5855:Stat2	UTSW	10	128283494	missense	probably damaging	1.00
R7459:Stat2	UTSW	10	128276565	missense	possibly damaging	0.95
R7467:Stat2	UTSW	10	128277903	splice site	probably null
R7599:Stat2	UTSW	10	128277197	missense	possibly damaging	0.45
R7756:Stat2	UTSW	10	128290728	small deletion	probably benign
R7814:Stat2	UTSW	10	128290728	small deletion	probably benign
R7992:Stat2	UTSW	10	128284962	missense	probably damaging	1.00
R8335:Stat2	UTSW	10	128276583	missense	possibly damaging	0.77
R8825:Stat2	UTSW	10	128291364	missense	possibly damaging	0.70
R9052:Stat2	UTSW	10	128281669	missense	probably damaging	1.00
R9104:Stat2	UTSW	10	128281242	critical splice donor site	probably null
R9244:Stat2	UTSW	10	128282765	missense	possibly damaging	0.93
R9405:Stat2	UTSW	10	128278765	missense	probably damaging	0.99
R9433:Stat2	UTSW	10	128276788	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGTTCAACATGCTCAGCCC -3'
(R):5'- ACAGCGCATCCTCCATCTTG -3'

Sequencing Primer
(F):5'- CCCAAATCCCAAGGTAGGAGG -3'
(R):5'- CAGCTCTTTCCTGTGGATCAGAG -3'

Posted On

2018-08-01