Incidental Mutation 'R6752:Stat2'
ID530841
Institutional Source Beutler Lab
Gene Symbol Stat2
Ensembl Gene ENSMUSG00000040033
Gene Namesignal transducer and activator of transcription 2
Synonyms1600010G07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_019963.1; Ensembl: ENSMUST00000085708

Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6752 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128270559-128292849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128283753 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 503 (F503L)
Ref Sequence ENSEMBL: ENSMUSP00000100872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]
Predicted Effect probably damaging
Transcript: ENSMUST00000085708
AA Change: F502L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033
AA Change: F502L

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105238
AA Change: F503L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033
AA Change: F503L

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220277
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,195,483 L45S probably benign Het
Agbl2 G A 2: 90,803,074 C518Y probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aox1 T C 1: 58,047,239 I101T probably benign Het
Arhgap23 T C 11: 97,452,248 F241S probably damaging Het
Asmt A G X: 170,676,361 M202V probably benign Het
Atp6v0a2 A G 5: 124,641,514 E189G probably damaging Het
Birc3 G A 9: 7,857,344 A376V probably benign Het
Ccbe1 C T 18: 66,076,307 probably null Het
Chst2 C A 9: 95,404,749 E515* probably null Het
Col12a1 A T 9: 79,633,424 N2426K possibly damaging Het
Dmrt2 A G 19: 25,678,342 N435S probably damaging Het
Dnah14 A G 1: 181,593,452 K123E probably benign Het
Dock4 T A 12: 40,820,617 L1452Q probably damaging Het
Galnt7 G A 8: 57,652,951 R10C probably damaging Het
Gm16506 A G 14: 43,727,419 I22T unknown Het
H2-Q6 A G 17: 35,428,127 T292A probably damaging Het
Ifne A G 4: 88,880,082 M33T probably benign Het
Igf2r G A 17: 12,714,944 R808W probably damaging Het
Igfbp5 T C 1: 72,863,909 E169G probably damaging Het
Inppl1 G A 7: 101,832,542 R198* probably null Het
Irgm1 T C 11: 48,866,463 T174A probably damaging Het
Itih3 C T 14: 30,923,489 G21S possibly damaging Het
Klra4 G T 6: 130,062,028 Q134K probably benign Het
Mfsd1 T A 3: 67,596,603 Y309* probably null Het
Mrps10 A G 17: 47,377,815 N162S probably damaging Het
Mtmr14 T C 6: 113,240,397 F90S probably damaging Het
Myh15 A G 16: 49,182,927 D1783G probably damaging Het
Myo3b A G 2: 70,289,512 E972G probably damaging Het
Myt1 G T 2: 181,801,082 V455F probably damaging Het
Nbea T A 3: 55,968,309 T1647S probably benign Het
Nbea A T 3: 56,037,219 S575T probably benign Het
Ntn4 A G 10: 93,734,175 N466S probably benign Het
Olfr1113 A G 2: 87,213,044 M51V probably benign Het
Olfr1468-ps1 T A 19: 13,375,526 L188H unknown Het
Olfr197 T A 16: 59,186,331 N51Y probably damaging Het
Pcdhgb4 T A 18: 37,720,651 I33N probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pom121l2 T G 13: 21,981,769 F70C probably damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Rab11fip2 T C 19: 59,907,043 D471G probably damaging Het
Rnh1 A G 7: 141,163,441 V207A probably benign Het
Sh3tc2 C A 18: 61,961,037 T49N probably benign Het
Skint4 T C 4: 112,119,863 M158T possibly damaging Het
Skint7 T A 4: 111,980,266 H80Q probably benign Het
Smg1 A G 7: 118,163,316 probably benign Het
Sostdc1 T C 12: 36,314,412 V40A probably benign Het
Sptlc1 C A 13: 53,335,358 K437N possibly damaging Het
Syt16 A T 12: 74,229,213 probably null Het
Tspyl1 T C 10: 34,282,587 S103P probably benign Het
Ube4a A T 9: 44,925,948 S1053R probably damaging Het
Vipr1 A G 9: 121,653,893 N58S probably damaging Het
Zfp184 C A 13: 21,959,408 A428E probably damaging Het
Zfp292 A C 4: 34,808,593 F1484V possibly damaging Het
Zfp599 G A 9: 22,249,544 H442Y probably damaging Het
Zfp944 G A 17: 22,339,519 T249I probably benign Het
Zkscan14 T A 5: 145,195,506 H405L probably damaging Het
Other mutations in Stat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Stat2 APN 10 128281176 missense probably benign 0.42
IGL02528:Stat2 APN 10 128290665 missense probably benign 0.07
IGL02859:Stat2 APN 10 128276611 missense probably damaging 1.00
IGL03119:Stat2 APN 10 128283517 missense probably benign 0.15
numb UTSW 10 128281065 splice site probably null
1mM(1):Stat2 UTSW 10 128277723 missense probably benign 0.06
R0098:Stat2 UTSW 10 128283262 missense probably damaging 1.00
R0334:Stat2 UTSW 10 128277867 missense probably damaging 1.00
R0496:Stat2 UTSW 10 128276509 missense probably benign 0.04
R1478:Stat2 UTSW 10 128282100 critical splice acceptor site probably null
R2857:Stat2 UTSW 10 128276901 splice site probably null
R3698:Stat2 UTSW 10 128278793 missense probably benign 0.30
R3870:Stat2 UTSW 10 128277893 missense probably benign 0.17
R5231:Stat2 UTSW 10 128281242 critical splice donor site probably null
R5235:Stat2 UTSW 10 128291032 critical splice donor site probably null
R5264:Stat2 UTSW 10 128281065 splice site probably null
R5855:Stat2 UTSW 10 128283494 missense probably damaging 1.00
R7459:Stat2 UTSW 10 128276565 missense possibly damaging 0.95
R7467:Stat2 UTSW 10 128277903 splice site probably null
R7599:Stat2 UTSW 10 128277197 missense possibly damaging 0.45
R7756:Stat2 UTSW 10 128290728 small deletion probably benign
R7814:Stat2 UTSW 10 128290728 small deletion probably benign
R7992:Stat2 UTSW 10 128284962 missense probably damaging 1.00
R8335:Stat2 UTSW 10 128276583 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGTTCAACATGCTCAGCCC -3'
(R):5'- ACAGCGCATCCTCCATCTTG -3'

Sequencing Primer
(F):5'- CCCAAATCCCAAGGTAGGAGG -3'
(R):5'- CAGCTCTTTCCTGTGGATCAGAG -3'
Posted On2018-08-01