Incidental Mutation 'R1177:Nop58'
ID100022
Institutional Source Beutler Lab
Gene Symbol Nop58
Ensembl Gene ENSMUSG00000026020
Gene NameNOP58 ribonucleoprotein
SynonymsMSSP, SIK similar protein, Nol5
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59684971-59719044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59700932 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 161 (M161K)
Ref Sequence ENSEMBL: ENSMUSP00000140250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027174] [ENSMUST00000185772] [ENSMUST00000189327] [ENSMUST00000190231] [ENSMUST00000190265] [ENSMUST00000191142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027174
AA Change: M161K

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027174
Gene: ENSMUSG00000026020
AA Change: M161K

DomainStartEndE-ValueType
Pfam:NOP5NT 2 66 1.1e-25 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185368
Predicted Effect probably benign
Transcript: ENSMUST00000185772
Predicted Effect probably benign
Transcript: ENSMUST00000187491
Predicted Effect probably benign
Transcript: ENSMUST00000187837
Predicted Effect probably benign
Transcript: ENSMUST00000188390
Predicted Effect probably benign
Transcript: ENSMUST00000189327
SMART Domains Protein: ENSMUSP00000139517
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
Pfam:NOP5NT 1 60 2.1e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000189919
AA Change: M86K
Predicted Effect probably benign
Transcript: ENSMUST00000190231
Predicted Effect probably damaging
Transcript: ENSMUST00000190265
AA Change: M31K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141100
Gene: ENSMUSG00000026020
AA Change: M31K

DomainStartEndE-ValueType
NOSIC 31 83 2.1e-33 SMART
low complexity region 88 109 N/A INTRINSIC
Pfam:Nop 123 179 5.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190759
Predicted Effect probably damaging
Transcript: ENSMUST00000191142
AA Change: M161K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140250
Gene: ENSMUSG00000026020
AA Change: M161K

DomainStartEndE-ValueType
Pfam:NOP5NT 1 66 3.2e-26 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
Pfam:Nop 253 401 2.7e-63 PFAM
coiled coil region 441 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core component of box C/D small nucleolar ribonucleoproteins. Some box C/D small nucleolar RNAs (snoRNAs), such as U3, U8, and U14, are dependent upon the encoded protein for their synthesis. This protein is SUMOylated, which is necessary for high affinity binding to snoRNAs. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Nop58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Nop58 APN 1 59704083 missense probably damaging 0.98
R0584:Nop58 UTSW 1 59706760 missense probably benign 0.00
R1170:Nop58 UTSW 1 59704211 splice site probably benign
R1485:Nop58 UTSW 1 59698345 missense probably damaging 0.98
R1588:Nop58 UTSW 1 59702872 missense probably damaging 1.00
R4715:Nop58 UTSW 1 59696026 missense probably benign 0.00
R5611:Nop58 UTSW 1 59710513 unclassified probably benign
R5933:Nop58 UTSW 1 59704665 nonsense probably null
R5979:Nop58 UTSW 1 59702831 missense probably damaging 1.00
R6010:Nop58 UTSW 1 59700912 missense probably damaging 1.00
R6244:Nop58 UTSW 1 59702855 missense probably damaging 1.00
R6371:Nop58 UTSW 1 59711312 unclassified probably benign
R7210:Nop58 UTSW 1 59710380 intron probably null
Predicted Primers
Posted On2014-01-15