Incidental Mutation 'R1183:Jak3'
ID101755
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene NameJanus kinase 3
Synonymsfae; wil
MMRRC Submission 039255-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R1183 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71676296-71690575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71684550 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 752 (I752F)
Ref Sequence ENSEMBL: ENSMUSP00000105640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034261] [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
Predicted Effect probably benign
Transcript: ENSMUST00000034261
SMART Domains Protein: ENSMUSP00000034261
Gene: ENSMUSG00000079019

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
IlGF 26 120 2.46e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000051995
AA Change: I752F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: I752F

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110012
AA Change: I752F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: I752F

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110013
AA Change: I752F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: I752F

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133263
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,895,303 L366Q possibly damaging Het
Aars T G 8: 111,041,574 Y192* probably null Het
Abcc6 T C 7: 45,985,253 Y1100C probably damaging Het
Adamtsl2 T C 2: 27,084,080 W132R probably damaging Het
Adgra2 T A 8: 27,114,388 V497E probably damaging Het
Adtrp T G 13: 41,828,337 probably benign Het
Alg9 T A 9: 50,789,533 L201Q possibly damaging Het
Ap4e1 T A 2: 127,014,201 I84K probably damaging Het
Atrnl1 T C 19: 57,650,293 S288P probably damaging Het
Cacna1a A G 8: 84,580,217 D1367G probably damaging Het
Card19 C T 13: 49,205,251 R82Q probably damaging Het
Cep128 T C 12: 91,325,598 I226V possibly damaging Het
Ces1f A C 8: 93,268,005 D259E probably benign Het
Ckap5 T A 2: 91,586,266 M1072K probably benign Het
Dcpp2 T A 17: 23,900,494 V94D probably benign Het
Dnah2 T C 11: 69,446,648 D3209G possibly damaging Het
Dsg1c A G 18: 20,283,198 T719A probably damaging Het
Dsp G A 13: 38,191,740 W1167* probably null Het
Eml5 T C 12: 98,792,046 I1874V probably benign Het
Epg5 A G 18: 77,960,711 T645A probably damaging Het
F2rl2 T C 13: 95,701,113 L222S probably damaging Het
Fam114a1 T A 5: 65,034,388 C495S probably damaging Het
Fbn1 A T 2: 125,321,617 D2106E probably benign Het
Fgf14 T A 14: 124,676,524 N65I probably benign Het
Fip1l1 T C 5: 74,595,102 Y497H probably damaging Het
Fn1 A C 1: 71,586,245 D2376E probably damaging Het
Foxd2 T C 4: 114,907,465 T453A possibly damaging Het
Galnt1 G T 18: 24,271,590 W328L probably damaging Het
Gapt A G 13: 110,353,838 V97A possibly damaging Het
Gatad1 A G 5: 3,643,707 V154A possibly damaging Het
Gdf15 A G 8: 70,631,552 F21L probably benign Het
Igdcc4 T C 9: 65,121,900 F273S possibly damaging Het
Invs A T 4: 48,421,725 R786W possibly damaging Het
Itfg1 T G 8: 85,780,523 E236A probably benign Het
Kcnip3 C A 2: 127,465,065 G144W probably damaging Het
Kctd19 T C 8: 105,382,966 H925R probably benign Het
Kdr C T 5: 75,946,851 A1011T probably damaging Het
Kif13b C A 14: 64,782,377 H1398Q probably benign Het
Lrp4 A T 2: 91,477,519 probably null Het
Lrtm2 T C 6: 119,320,885 D65G probably benign Het
Lyz1 A G 10: 117,292,810 L10P probably damaging Het
Metap2 A T 10: 93,870,184 N245K probably damaging Het
Mms19 T C 19: 41,954,831 D297G possibly damaging Het
Mocs3 A G 2: 168,231,653 D340G possibly damaging Het
Mtfr1l A G 4: 134,529,125 L243P probably damaging Het
Mtss1 A G 15: 58,971,048 I105T probably damaging Het
Myo18a T C 11: 77,857,745 S1967P probably damaging Het
Ncor2 T C 5: 125,023,521 N2248S possibly damaging Het
Nfatc2 T C 2: 168,590,088 D35G possibly damaging Het
Nup210l T A 3: 90,159,945 M764K probably benign Het
Olfr519 A G 7: 108,893,741 L222P probably damaging Het
Otof T C 5: 30,371,912 S1753G probably damaging Het
Otog G A 7: 46,289,755 V2070I probably benign Het
Piezo2 A G 18: 63,086,753 V961A probably damaging Het
Pofut1 C T 2: 153,261,238 S169L probably benign Het
Ppp1r10 T A 17: 35,929,443 S542T possibly damaging Het
Prpf8 T C 11: 75,490,330 Y219H possibly damaging Het
Ptges3l T C 11: 101,421,905 D113G possibly damaging Het
Pycrl G A 15: 75,918,798 L71F probably benign Het
Ramp3 A G 11: 6,674,867 K54E possibly damaging Het
Rbpms C A 8: 33,804,072 Q214H possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo4 C A 9: 37,408,052 D565E probably damaging Het
S100a1 C T 3: 90,511,334 V58I probably benign Het
Setx T A 2: 29,180,092 D2636E probably benign Het
Sun2 A T 15: 79,728,468 V417E probably damaging Het
Tbccd1 T C 16: 22,841,769 N99S probably benign Het
Tex15 A G 8: 33,574,865 D1441G probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Trim32 A G 4: 65,614,391 Y395C probably benign Het
Trpm2 A G 10: 77,923,564 Y1129H probably damaging Het
Trpm8 A T 1: 88,348,091 R470S probably damaging Het
Tsg101 G T 7: 46,889,624 D389E probably benign Het
Ubn1 T C 16: 5,064,542 L46P probably damaging Het
Ubr5 T C 15: 37,997,175 I1745V possibly damaging Het
Usp20 T C 2: 31,011,785 Y521H probably benign Het
Vmn1r159 A T 7: 22,843,594 H4Q probably null Het
Vmn2r27 T A 6: 124,200,532 E504D probably benign Het
Wdr72 A T 9: 74,179,585 I612F probably benign Het
Zbtb8a T C 4: 129,357,727 H317R possibly damaging Het
Zfp507 T C 7: 35,794,890 S243G probably damaging Het
Zfp764 A G 7: 127,406,247 W73R probably damaging Het
Zmym4 A T 4: 126,925,839 D90E probably damaging Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice site probably benign
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.24
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice site probably null
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 unclassified probably null
IGL02752:Jak3 APN 8 71682951 missense possibly damaging 0.50
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.15
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
citron UTSW 8 71686976 splice site probably benign
daniels UTSW 8 71681655 missense possibly damaging 0.48
Deposuit UTSW 8 71685404 missense probably damaging 1.00
distortion UTSW 8 71683978 missense probably damaging 1.00
Downcast UTSW 8 71685511 missense probably benign 0.07
fake_news UTSW 8 71685957 missense probably damaging 1.00
Implevit UTSW 8 71678773 missense probably benign
mount_tai UTSW 8 71683377 missense probably damaging 1.00
potentes UTSW 8 71686058 missense probably damaging 0.99
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 71684349 missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 71679642 missense probably benign 0.21
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice site probably benign
R0531:Jak3 UTSW 8 71686976 splice site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0612:Jak3 UTSW 8 71683377 missense probably damaging 1.00
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.75
R1793:Jak3 UTSW 8 71685946 splice site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense possibly damaging 0.95
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 unclassified probably benign
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.48
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.99
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5799:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.68
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
R6260:Jak3 UTSW 8 71679310 missense probably benign 0.00
R6798:Jak3 UTSW 8 71680971 missense probably damaging 0.99
R7013:Jak3 UTSW 8 71678781 missense possibly damaging 0.88
R7070:Jak3 UTSW 8 71684611 missense probably damaging 1.00
R7122:Jak3 UTSW 8 71685957 missense probably damaging 1.00
R7166:Jak3 UTSW 8 71682316 missense probably damaging 1.00
R7225:Jak3 UTSW 8 71685511 missense probably benign 0.07
R7440:Jak3 UTSW 8 71680718 missense probably benign 0.02
R7489:Jak3 UTSW 8 71684292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCATGACAGTTCTCACTCCCAC -3'
(R):5'- TGACTGCTAGAACCAGCAAACTTCC -3'

Sequencing Primer
(F):5'- TCAGACACTCGGCTTGGAG -3'
(R):5'- AACTTCCTGGACCCAGCTC -3'
Posted On2014-01-15