Incidental Mutation 'R1269:Abcc3'
ID151255
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 3
SynonymsMRP3, 1700019L09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94343295-94392997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94357384 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1129 (R1129Q)
Ref Sequence ENSEMBL: ENSMUSP00000021231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]
Predicted Effect probably damaging
Transcript: ENSMUST00000021231
AA Change: R1129Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: R1129Q

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178136
AA Change: R1130Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: R1130Q

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1375:Abcc3 UTSW 11 94352216 missense possibly damaging 0.46
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4425:Abcc3 UTSW 11 94346044 missense probably damaging 0.98
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R4877:Abcc3 UTSW 11 94367595 missense probably damaging 0.98
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5682:Abcc3 UTSW 11 94392897 missense probably benign 0.31
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R6953:Abcc3 UTSW 11 94374835 missense probably benign 0.03
R7054:Abcc3 UTSW 11 94365225 missense probably benign 0.01
R7131:Abcc3 UTSW 11 94365031 missense probably damaging 1.00
R7210:Abcc3 UTSW 11 94373941 missense probably benign 0.03
R7283:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7284:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7285:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7287:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7320:Abcc3 UTSW 11 94367645 missense probably benign 0.33
R7450:Abcc3 UTSW 11 94361695 missense probably damaging 1.00
R7469:Abcc3 UTSW 11 94368188 missense probably damaging 1.00
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATTCAAGCTGTTTCTCCCGATCAC -3'
(R):5'- GTTCTCCAAGAAAGTGTAGGAAGCTCG -3'

Sequencing Primer
(F):5'- CAGCCATCTGTAGGGACCAAG -3'
(R):5'- TCGAGCGAGGCTTGTGG -3'
Posted On2014-01-29