Incidental Mutation 'R1345:Olfr813'
ID156468
Institutional Source Beutler Lab
Gene Symbol Olfr813
Ensembl Gene ENSMUSG00000052818
Gene Nameolfactory receptor 813
SynonymsMOR108-3, GA_x6K02T2PULF-11535078-11536010
MMRRC Submission 039410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1345 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129855367-129858722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129856890 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 124 (I124T)
Ref Sequence ENSEMBL: ENSMUSP00000145260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064893] [ENSMUST00000204622]
Predicted Effect probably damaging
Transcript: ENSMUST00000064893
AA Change: I124T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063431
Gene: ENSMUSG00000052818
AA Change: I124T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-49 PFAM
Pfam:7tm_1 39 288 3.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204622
AA Change: I124T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: I124T

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,718 V129I probably damaging Het
Akr1c18 T C 13: 4,145,214 T82A possibly damaging Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Atr A G 9: 95,920,355 T1767A probably benign Het
Brf1 A T 12: 112,961,108 probably null Het
Cd86 A G 16: 36,618,324 probably null Het
Cdan1 A G 2: 120,719,139 probably null Het
Cntln A G 4: 84,973,991 D371G probably damaging Het
Cypt4 A G 9: 24,625,219 T2A possibly damaging Het
Dll1 G T 17: 15,373,555 Y183* probably null Het
Dnmt1 G T 9: 20,908,518 P1444Q probably damaging Het
Ern2 A G 7: 122,177,770 L309P probably damaging Het
Fam151a A G 4: 106,742,294 K142E probably damaging Het
Fbn1 T C 2: 125,314,671 E2378G probably damaging Het
Gm9573 T A 17: 35,621,597 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kdm5b A C 1: 134,630,550 T1432P possibly damaging Het
Kif2a G A 13: 106,993,915 S15F probably damaging Het
Lzic A G 4: 149,486,851 E31G probably damaging Het
Mmp16 A G 4: 18,112,021 M466V probably benign Het
Mtm1 T C X: 71,287,231 V203A probably benign Het
Neurl4 A G 11: 69,903,876 M249V probably benign Het
Plxna2 T C 1: 194,644,486 Y243H probably damaging Het
Rbm44 A G 1: 91,152,759 N223S probably damaging Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Simc1 A ANNNNNNNNNNNNNNNNNNNNN 13: 54,525,247 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Spata31d1d T G 13: 59,726,024 K1232N possibly damaging Het
Spink5 A T 18: 43,990,682 E345D possibly damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem232 T C 17: 65,450,406 N264S possibly damaging Het
Trim43b G C 9: 89,085,672 L303V possibly damaging Het
Tulp2 C A 7: 45,518,721 R298S probably benign Het
Usp42 A G 5: 143,717,333 V511A probably damaging Het
Vav1 A T 17: 57,301,214 T321S probably benign Het
Vmn1r169 A C 7: 23,577,822 H213P probably damaging Het
Vmn1r170 C T 7: 23,606,362 T63I probably benign Het
Vmn2r103 T G 17: 19,794,247 W434G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp7 T C 15: 76,890,708 S317P probably damaging Het
Other mutations in Olfr813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Olfr813 APN 10 129856628 missense probably benign 0.00
IGL01650:Olfr813 APN 10 129857067 missense probably damaging 1.00
IGL01734:Olfr813 APN 10 129856802 missense probably benign 0.36
IGL01909:Olfr813 APN 10 129857081 missense probably damaging 0.99
R0256:Olfr813 UTSW 10 129857037 missense probably damaging 1.00
R0607:Olfr813 UTSW 10 129857201 missense possibly damaging 0.67
R0924:Olfr813 UTSW 10 129856646 missense probably damaging 1.00
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R2344:Olfr813 UTSW 10 129856541 missense probably benign 0.01
R3851:Olfr813 UTSW 10 129857147 missense probably benign 0.00
R4486:Olfr813 UTSW 10 129856698 missense probably damaging 1.00
R4934:Olfr813 UTSW 10 129857027 missense possibly damaging 0.91
R5397:Olfr813 UTSW 10 129856710 missense probably damaging 1.00
R5644:Olfr813 UTSW 10 129857427 missense probably benign 0.38
R5925:Olfr813 UTSW 10 129856875 missense probably damaging 1.00
R6224:Olfr813 UTSW 10 129857192 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTGCTGGATTCCCACCTGAAGAC -3'
(R):5'- AACAGAGGTGTTGAGCATAGCCAC -3'

Sequencing Primer
(F):5'- GAAGACACCCATGTATTTCTTCC -3'
(R):5'- CATGAAGATGCAGCTTCCATAG -3'
Posted On2014-02-11