Incidental Mutation 'R1450:Ccdc185'
ID162121
Institutional Source Beutler Lab
Gene Symbol Ccdc185
Ensembl Gene ENSMUSG00000043429
Gene Namecoiled-coil domain containing 185
Synonyms4922505E12Rik
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1450 (G1)
Quality Score191
Status Validated
Chromosome1
Chromosomal Location182747126-182749180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 182747564 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 520 (Q520P)
Ref Sequence ENSEMBL: ENSMUSP00000095053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060041]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060041
AA Change: Q520P

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095053
Gene: ENSMUSG00000043429
AA Change: Q520P

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
Pfam:DUF4659 239 618 3.2e-119 PFAM
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Ccdc185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Ccdc185 APN 1 182747423 missense possibly damaging 0.85
IGL01121:Ccdc185 APN 1 182748657 missense probably benign 0.33
IGL01143:Ccdc185 APN 1 182747852 missense probably damaging 0.98
IGL01721:Ccdc185 APN 1 182748978 missense possibly damaging 0.53
IGL01941:Ccdc185 APN 1 182748204 missense probably benign 0.32
IGL01945:Ccdc185 APN 1 182748876 missense probably benign 0.33
IGL03333:Ccdc185 APN 1 182748833 missense probably damaging 1.00
ratas UTSW 1 182749017 missense possibly damaging 0.73
ratones UTSW 1 182747520 missense possibly damaging 0.52
R0486:Ccdc185 UTSW 1 182747859 missense possibly damaging 0.86
R0653:Ccdc185 UTSW 1 182747564 missense possibly damaging 0.52
R1263:Ccdc185 UTSW 1 182747353 nonsense probably null
R1464:Ccdc185 UTSW 1 182748698 missense probably benign
R1464:Ccdc185 UTSW 1 182748698 missense probably benign
R2146:Ccdc185 UTSW 1 182747520 missense possibly damaging 0.52
R3409:Ccdc185 UTSW 1 182748748 missense possibly damaging 0.73
R3410:Ccdc185 UTSW 1 182748748 missense possibly damaging 0.73
R3765:Ccdc185 UTSW 1 182747552 missense possibly damaging 0.71
R4012:Ccdc185 UTSW 1 182748888 missense possibly damaging 0.91
R4953:Ccdc185 UTSW 1 182749017 missense possibly damaging 0.73
R5096:Ccdc185 UTSW 1 182748789 missense possibly damaging 0.73
R5166:Ccdc185 UTSW 1 182748999 nonsense probably null
R5300:Ccdc185 UTSW 1 182748080 missense probably benign 0.00
R5504:Ccdc185 UTSW 1 182747627 missense probably damaging 0.97
R5863:Ccdc185 UTSW 1 182748557 missense possibly damaging 0.53
R5928:Ccdc185 UTSW 1 182747482 missense probably benign 0.00
R7127:Ccdc185 UTSW 1 182748856 missense not run
Predicted Primers PCR Primer
(F):5'- ATGGCTTCCTTGATGCCCTTGATG -3'
(R):5'- TGGATGGTTCAAGCTGACAACCCG -3'

Sequencing Primer
(F):5'- TGATGCCCTTGATGTGACAC -3'
(R):5'- AAGGTTCTCATGGACTGCCAG -3'
Posted On2014-03-14