Incidental Mutation 'R1381:Pdzd2'
ID163056
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 039443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R1381 (G1)
Quality Score156
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12385439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1082 (S1082P)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect probably benign
Transcript: ENSMUST00000075317
AA Change: S1082P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: S1082P

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,731,086 F252L probably benign Het
Aadac A T 3: 60,039,930 M350L probably damaging Het
Agtrap G A 4: 148,083,965 T19I probably damaging Het
Apba3 C T 10: 81,271,756 T142M possibly damaging Het
Cd55b T A 1: 130,419,675 K133I probably damaging Het
Cep295 A C 9: 15,322,565 C2312G probably benign Het
Ces1a A G 8: 93,034,031 V231A probably damaging Het
Chdh C A 14: 30,036,834 L579I probably damaging Het
Cyb5r4 T A 9: 87,022,233 S19T probably benign Het
Cyp2d22 C A 15: 82,372,508 R355L probably benign Het
Dach2 T C X: 113,298,775 Y117H probably damaging Het
Dennd4c G A 4: 86,774,532 R93K probably benign Het
Dph2 G T 4: 117,889,668 L452I probably damaging Het
Exoc6b T C 6: 84,835,117 D634G probably benign Het
Fam217b G A 2: 178,420,425 V61I probably benign Het
Fbln7 A C 2: 128,877,379 Q32P probably damaging Het
Fgfr1op2 A G 6: 146,588,741 Y46C probably damaging Het
Fhod3 T A 18: 25,090,471 I958N probably damaging Het
Foxp2 T A 6: 15,409,766 M455K possibly damaging Het
Gabrr2 G A 4: 33,081,420 G152D probably damaging Het
Galntl6 G T 8: 58,472,955 P92Q probably damaging Het
Gm5592 A T 7: 41,286,172 T33S probably benign Het
Grid2ip A T 5: 143,362,651 T166S probably benign Het
Grsf1 G A 5: 88,665,864 S225L probably benign Het
Hadha G T 5: 30,128,836 T395K probably benign Het
Hars2 C T 18: 36,789,217 A295V possibly damaging Het
Hsf5 T A 11: 87,638,169 S577T probably benign Het
Ice2 A G 9: 69,400,527 Y31C probably damaging Het
Ift80 A T 3: 68,914,783 I643N possibly damaging Het
Iglon5 A T 7: 43,476,640 D222E probably benign Het
Ilvbl C A 10: 78,576,596 S50R probably damaging Het
Invs C A 4: 48,421,942 S858* probably null Het
Ipo13 T G 4: 117,904,395 T508P probably damaging Het
Itgb4 T C 11: 115,994,337 I1015T probably benign Het
Kank4 A T 4: 98,779,938 W91R probably damaging Het
Kansl1l C T 1: 66,720,904 A906T probably benign Het
Klk4 G A 7: 43,885,282 V222M probably damaging Het
Lipo4 T A 19: 33,499,341 M336L probably benign Het
Lrig1 T C 6: 94,606,130 N1002D probably benign Het
Lzts3 A G 2: 130,635,299 S524P probably damaging Het
Maz A T 7: 127,023,152 C409* probably null Het
Mmp24 A T 2: 155,814,127 Q495L possibly damaging Het
Mrgpra9 C T 7: 47,235,302 V206I possibly damaging Het
Myof A G 19: 37,995,485 Y124H probably damaging Het
Nalcn A T 14: 123,314,105 V1030D probably damaging Het
Neb T A 2: 52,260,532 I2495F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nup153 T C 13: 46,689,181 D837G probably damaging Het
Nup210 C A 6: 91,075,960 G331V probably damaging Het
Olfr1143 T C 2: 87,803,136 L245P probably damaging Het
Olfr1447 T C 19: 12,900,956 T275A probably benign Het
Olfr5 A G 7: 6,481,009 probably null Het
Olfr923 T A 9: 38,828,338 S210T probably benign Het
Pabpc4 T A 4: 123,289,059 L163H probably damaging Het
Papd5 T A 8: 88,243,309 M203K possibly damaging Het
Pcdh7 T A 5: 57,721,540 Y126* probably null Het
Pkd2l1 T C 19: 44,150,463 I649M probably benign Het
Plcl2 G A 17: 50,607,729 E589K probably damaging Het
Plppr1 C A 4: 49,337,674 T325N possibly damaging Het
Pqlc1 T G 18: 80,283,314 S126A probably benign Het
Prss8 GCTGCCCAAGTCCC GC 7: 127,929,849 probably benign Het
Ptcd2 A G 13: 99,344,597 S25P probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rusc2 T A 4: 43,416,137 V481E probably damaging Het
Sephs2 G T 7: 127,272,967 T318K probably damaging Het
Sf3b1 T A 1: 55,003,154 I497L probably damaging Het
Slc30a7 C T 3: 115,956,870 probably null Het
Smarca2 T C 19: 26,630,828 S96P probably damaging Het
Spata31d1c A C 13: 65,036,554 I637L probably benign Het
Ston2 A T 12: 91,740,492 S115T probably damaging Het
Tal2 A C 4: 53,785,999 E60A probably benign Het
Tdpoz3 A T 3: 93,826,140 T41S probably benign Het
Tespa1 T C 10: 130,360,691 I166T probably benign Het
Thsd7a A T 6: 12,555,439 C149S probably damaging Het
Trav6-1 T A 14: 52,638,510 probably benign Het
Txnl4a T C 18: 80,207,264 V25A probably benign Het
Utp4 C A 8: 106,906,276 P297Q probably benign Het
Vmn1r34 T C 6: 66,636,938 Y272C probably damaging Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Vmn2r121 C A X: 124,128,140 G728W probably damaging Het
Vmn2r24 T A 6: 123,786,733 S190T probably damaging Het
Zfp507 A G 7: 35,776,010 V926A possibly damaging Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACACGGTCCATTGGCTGTTTC -3'
(R):5'- CACTAGGTTTGCCTTGGCAACCTC -3'

Sequencing Primer
(F):5'- CCATTGGCTGTTTCACTTGG -3'
(R):5'- GGCAACCTCTTCCAAAAGTATTG -3'
Posted On2014-03-17