Incidental Mutation 'R1521:Mdga2'
ID167033
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66568926 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 636 (Y636H)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
Predicted Effect probably benign
Transcript: ENSMUST00000037181
AA Change: Y636H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Y636H

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: Y626H
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Y626H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222167
AA Change: Y567H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223141
AA Change: Y567H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223289
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense not run
Predicted Primers PCR Primer
(F):5'- GAAAGCTGCATCTCCCTGCTCC -3'
(R):5'- AGTCCTGTCTTGATTCTGTTTGTGCATC -3'

Sequencing Primer
(F):5'- GCTCCAGCTTCATTTATGATGC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2014-04-13