Incidental Mutation 'R1506:Ercc6'
ID167952
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32569864 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1062 (I1062F)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably benign
Transcript: ENSMUST00000066807
AA Change: I1062F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: I1062F

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228549
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCACTCTGACCAGTCCTGACG -3'
(R):5'- TCCACTCATCACTGAGAGATGCTCC -3'

Sequencing Primer
(F):5'- CACTGAGACAAGTGCTATTTTTGC -3'
(R):5'- CACTGAGAGATGCTCCAGTGTG -3'
Posted On2014-04-13