Incidental Mutation 'R1551:Vill'
ID169933
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Namevillin-like
SynonymsVillp
MMRRC Submission 039590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1551 (G1)
Quality Score91
Status Not validated
Chromosome9
Chromosomal Location119052778-119071525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119063372 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 357 (H357L)
Ref Sequence ENSEMBL: ENSMUSP00000074294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000131647] [ENSMUST00000136561] [ENSMUST00000141185]
Predicted Effect probably benign
Transcript: ENSMUST00000051386
AA Change: H357L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: H357L

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
AA Change: H357L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: H357L

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131647
SMART Domains Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
SCOP:d1d4xg_ 7 85 6e-23 SMART
Blast:GEL 14 85 1e-48 BLAST
PDB:2VIL|A 15 82 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000136561
SMART Domains Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 1 96 2.46e-13 SMART
Blast:GEL 116 140 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,318,878 I1534M probably benign Het
Acad11 G A 9: 104,126,586 A626T probably damaging Het
Akap9 T A 5: 4,069,174 N3560K probably benign Het
Aldh3a2 C T 11: 61,253,644 V363I probably benign Het
Anks1b A G 10: 90,076,981 T289A probably benign Het
Atp11a A G 8: 12,812,340 N64S probably damaging Het
Atp11c T C X: 60,236,712 probably null Het
Cd101 T C 3: 101,012,013 H591R probably damaging Het
Cd36 C T 5: 17,797,122 V294I probably benign Het
Cgref1 T C 5: 30,933,585 E295G probably benign Het
Cit A G 5: 115,945,842 M787V probably benign Het
Clcn6 G A 4: 148,012,778 P611S possibly damaging Het
Clec12a A C 6: 129,350,421 M1L probably damaging Het
Cmtm6 C T 9: 114,746,505 R161W probably damaging Het
Colec10 G T 15: 54,462,262 V163L probably damaging Het
Coq8b A G 7: 27,257,482 Y520C probably damaging Het
Ctsll3 C A 13: 60,801,007 E45* probably null Het
Dsg3 A G 18: 20,536,918 E663G possibly damaging Het
Dst G A 1: 34,192,212 R2962H probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fbxo36 T C 1: 84,881,114 I40T probably damaging Het
Fgd2 G A 17: 29,378,409 V568M probably damaging Het
Fmn1 T C 2: 113,525,862 Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,022,327 T199S possibly damaging Het
Gm12789 A G 4: 101,988,934 K131E probably benign Het
Gm17641 C A 3: 68,870,115 silent Het
Gm6665 G T 18: 31,820,287 R43S probably damaging Het
Gm7173 C A X: 79,488,645 L842F probably damaging Het
Gzmc T A 14: 56,232,746 H98L probably damaging Het
Hecw1 T A 13: 14,316,943 E75V probably damaging Het
Herc2 G T 7: 56,146,669 V1930L probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Htr6 A T 4: 139,074,465 C99* probably null Het
Lgals2 C T 15: 78,852,311 M16I probably benign Het
Lrrc8c A G 5: 105,608,224 N622D probably damaging Het
Myo15 A T 11: 60,492,965 I1613F possibly damaging Het
Oacyl C T 18: 65,742,209 R455C probably benign Het
Olfr1323 T C X: 50,009,995 T81A possibly damaging Het
Olfr203 T A 16: 59,303,403 N84K probably benign Het
Olfr272 A T 4: 52,911,397 Y132* probably null Het
Orm3 A G 4: 63,356,909 probably null Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Phf2 G C 13: 48,832,103 T67S unknown Het
Pigt T C 2: 164,507,403 V542A probably damaging Het
Pnpla7 T C 2: 25,047,708 F992L probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Pramef6 A G 4: 143,895,693 M364T probably benign Het
Prmt7 A G 8: 106,237,382 T303A probably benign Het
Prpf4b A T 13: 34,894,443 I679F possibly damaging Het
Psd4 T A 2: 24,403,280 M719K probably benign Het
Ranbp9 A T 13: 43,425,117 M160K probably benign Het
Rfc1 A G 5: 65,277,363 Y687H probably damaging Het
Rimbp2 T C 5: 128,806,359 K119R probably damaging Het
Rnf113a1 T C X: 37,191,393 M1T probably null Het
Rnf40 A C 7: 127,596,334 K511Q possibly damaging Het
Ryr2 T A 13: 11,785,143 probably null Het
Scrib A T 15: 76,065,162 V365E probably damaging Het
Slc6a17 A G 3: 107,472,127 V575A possibly damaging Het
Spta1 A G 1: 174,240,166 N2053S possibly damaging Het
Ssbp2 G A 13: 91,642,392 probably null Het
Stab1 G T 14: 31,160,499 N460K probably benign Het
Tbc1d9 T A 8: 83,266,158 C964S probably benign Het
Tmed11 A G 5: 108,779,814 probably null Het
Tmem191c C A 16: 17,278,120 R285S probably damaging Het
Tpr T C 1: 150,436,801 S1917P probably benign Het
Vmn1r229 A G 17: 20,814,789 T99A probably benign Het
Vmn2r14 A G 5: 109,221,417 S97P probably damaging Het
Wasf2 G T 4: 133,190,172 R194L unknown Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 119063312 missense probably damaging 1.00
IGL01024:Vill APN 9 119070350 critical splice donor site probably null
IGL01934:Vill APN 9 119066809 missense probably damaging 1.00
IGL02118:Vill APN 9 119060398 missense probably benign 0.44
IGL02260:Vill APN 9 119058441 missense probably benign 0.00
IGL02507:Vill APN 9 119070777 missense possibly damaging 0.86
IGL02870:Vill APN 9 119061899 missense probably damaging 1.00
IGL02941:Vill APN 9 119066887 unclassified probably benign
IGL02835:Vill UTSW 9 119067445 missense probably benign 0.11
R0285:Vill UTSW 9 119070827 unclassified probably benign
R0571:Vill UTSW 9 119070633 missense possibly damaging 0.93
R1024:Vill UTSW 9 119066824 missense probably damaging 1.00
R1168:Vill UTSW 9 119070321 missense probably damaging 0.99
R1374:Vill UTSW 9 119061494 missense probably benign 0.03
R1400:Vill UTSW 9 119063347 missense probably benign 0.01
R1584:Vill UTSW 9 119065586 missense probably damaging 1.00
R1630:Vill UTSW 9 119070701 missense probably benign 0.37
R1721:Vill UTSW 9 119066014 missense probably damaging 0.98
R1946:Vill UTSW 9 119058492 missense probably benign
R2311:Vill UTSW 9 119065897 missense probably benign 0.08
R2392:Vill UTSW 9 119067560 unclassified probably benign
R2509:Vill UTSW 9 119070302 missense possibly damaging 0.84
R2760:Vill UTSW 9 119066882 critical splice donor site probably null
R3886:Vill UTSW 9 119066714 missense probably benign 0.24
R3944:Vill UTSW 9 119068431 missense probably benign 0.10
R4245:Vill UTSW 9 119071291 unclassified probably benign
R4246:Vill UTSW 9 119060393 missense probably damaging 1.00
R4771:Vill UTSW 9 119068434 missense probably damaging 1.00
R4889:Vill UTSW 9 119063341 missense possibly damaging 0.50
R4932:Vill UTSW 9 119061511 missense probably damaging 1.00
R4946:Vill UTSW 9 119068440 missense probably damaging 1.00
R5121:Vill UTSW 9 119070025 missense possibly damaging 0.92
R5646:Vill UTSW 9 119071162 missense probably damaging 1.00
R6089:Vill UTSW 9 119057799 missense probably benign 0.00
R6149:Vill UTSW 9 119058414 missense possibly damaging 0.67
R6167:Vill UTSW 9 119066864 missense probably damaging 0.98
R6318:Vill UTSW 9 119063648 missense probably benign 0.15
R6319:Vill UTSW 9 119063648 missense probably benign 0.15
R6590:Vill UTSW 9 119061907 missense probably benign 0.04
R6690:Vill UTSW 9 119061907 missense probably benign 0.04
R6889:Vill UTSW 9 119065882 missense possibly damaging 0.58
R7207:Vill UTSW 9 119071213 missense possibly damaging 0.64
R7353:Vill UTSW 9 119065493 missense probably damaging 0.99
R7398:Vill UTSW 9 119070648 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTGCAGGAGCCAGCTTGTTAAATG -3'
(R):5'- GTCAGTGATGTTCTTCAGGACCACC -3'

Sequencing Primer
(F):5'- CCAGCTTGTTAAATGGGTCAC -3'
(R):5'- GGCCGAATCACTCCTCAC -3'
Posted On2014-04-13