Incidental Mutation 'R1560:Hmbs'
ID170557
Institutional Source Beutler Lab
Gene Symbol Hmbs
Ensembl Gene ENSMUSG00000032126
Gene Namehydroxymethylbilane synthase
Synonymsporphobilinogen deaminase, PBGD, Uros1, Ups
MMRRC Submission 039599-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1560 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44336339-44344228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44337360 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 72 (H72R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000054708] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215050] [ENSMUST00000215091] [ENSMUST00000216852]
Predicted Effect probably benign
Transcript: ENSMUST00000052686
SMART Domains Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932

DomainStartEndE-ValueType
H2A 3 123 1.64e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054708
SMART Domains Protein: ENSMUSP00000056282
Gene: ENSMUSG00000032123

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Glycos_transf_4 100 272 1.1e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077353
AA Change: H256R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126
AA Change: H256R

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097558
AA Change: H239R

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126
AA Change: H239R

DomainStartEndE-ValueType
Pfam:Porphobil_deam 3 219 3.9e-95 PFAM
Pfam:Porphobil_deamC 227 327 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214967
Predicted Effect probably benign
Transcript: ENSMUST00000215050
Predicted Effect probably benign
Transcript: ENSMUST00000215091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215934
Predicted Effect possibly damaging
Transcript: ENSMUST00000216658
AA Change: H72R

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000216852
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for one null allele and a functional allele with a milder mutation exhibit typical features of acute intermittent porphyria with massive urinary excretion of aminolevulinic acid after phenobarbital treatment, erythruria, ataxia, motor dysfunction, and neurologic muscle atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,626,042 T390A probably benign Het
Adamts8 T A 9: 30,956,667 C596S probably damaging Het
Avl9 T A 6: 56,725,128 Y89* probably null Het
Cacna1e G A 1: 154,421,104 R18* probably null Het
Cacng2 A G 15: 78,013,318 F97S probably benign Het
Calu A G 6: 29,361,658 D107G probably benign Het
Capns2 G A 8: 92,902,143 R220Q probably damaging Het
Catsperb C T 12: 101,625,726 T1105I probably benign Het
Cep350 T C 1: 155,929,079 N753D possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah5 G T 15: 28,420,003 V3816F probably damaging Het
Dzip3 T C 16: 48,951,540 probably null Het
Ep400 A T 5: 110,671,106 probably null Het
Epb41l2 T A 10: 25,495,436 probably null Het
Fetub T C 16: 22,939,367 V300A probably benign Het
Gabrb3 A T 7: 57,816,295 M308L probably damaging Het
Galnt16 A T 12: 80,601,792 D546V possibly damaging Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gpr158 A G 2: 21,826,314 K742E probably damaging Het
Krt16 A G 11: 100,246,649 I410T probably damaging Het
Lamb3 G A 1: 193,339,402 A971T probably benign Het
Lilra6 A C 7: 3,911,408 probably null Het
Mroh7 A T 4: 106,711,254 M418K possibly damaging Het
Myh11 T A 16: 14,226,620 K640* probably null Het
Nsd1 T A 13: 55,246,720 C711* probably null Het
Olfr1216 T C 2: 89,013,206 Y286C probably damaging Het
Olfr139 A G 11: 74,044,615 S220P probably damaging Het
Olfr318 A T 11: 58,720,687 Y120* probably null Het
Olfr346 T A 2: 36,688,143 L47Q probably damaging Het
Otop3 A T 11: 115,344,463 H307L possibly damaging Het
Plekhm3 T C 1: 64,937,817 T165A probably benign Het
Poldip3 G A 15: 83,138,326 R86W probably damaging Het
Rif1 A T 2: 52,111,131 R1532S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc27a6 T A 18: 58,579,832 L242* probably null Het
Spata45 T C 1: 191,039,820 S80P probably benign Het
Taf4 A G 2: 179,935,953 V525A probably benign Het
Tbck A G 3: 132,838,048 T887A probably damaging Het
Tnrc6c C T 11: 117,759,637 T1571I probably damaging Het
Trim38 A G 13: 23,782,702 Y44C probably benign Het
Tsg101 A T 7: 46,892,460 probably null Het
Tsku T A 7: 98,352,944 D60V probably damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Upf1 G A 8: 70,338,442 P550L probably damaging Het
Vipr2 A G 12: 116,094,781 D106G probably benign Het
Vps13c T C 9: 67,936,463 probably null Het
Washc4 T C 10: 83,556,109 Y220H probably damaging Het
Wdr81 C T 11: 75,451,623 W939* probably null Het
Zfp512b T C 2: 181,588,679 T473A probably benign Het
Other mutations in Hmbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Hmbs APN 9 44339548 missense possibly damaging 0.91
IGL02312:Hmbs APN 9 44341213 critical splice donor site probably null
R0386:Hmbs UTSW 9 44337008 missense probably benign 0.06
R0411:Hmbs UTSW 9 44341652 nonsense probably null
R0656:Hmbs UTSW 9 44337360 missense probably benign 0.31
R1503:Hmbs UTSW 9 44337432 missense probably benign 0.42
R1953:Hmbs UTSW 9 44337444 missense probably damaging 1.00
R2127:Hmbs UTSW 9 44340707 missense probably benign 0.09
R4637:Hmbs UTSW 9 44339537 missense probably damaging 1.00
R5549:Hmbs UTSW 9 44339477 critical splice donor site probably null
R6611:Hmbs UTSW 9 44341691 missense probably damaging 0.98
X0024:Hmbs UTSW 9 44337968 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGGAAATGACAGTCCCTCCCCTC -3'
(R):5'- TGGTTCATAACCTTTGGCACCTGC -3'

Sequencing Primer
(F):5'- TATGCACTGCTACGGGCAC -3'
(R):5'- GGCACCTGCTATCCATCAAATAAG -3'
Posted On2014-04-13