Incidental Mutation 'R1648:Ddx20'
ID174003
Institutional Source Beutler Lab
Gene Symbol Ddx20
Ensembl Gene ENSMUSG00000027905
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 20
SynonymsGEMIN3, dp103
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105678270-105687574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105679188 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 614 (I614V)
Ref Sequence ENSEMBL: ENSMUSP00000088176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090680] [ENSMUST00000200078]
Predicted Effect probably benign
Transcript: ENSMUST00000090680
AA Change: I614V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088176
Gene: ENSMUSG00000027905
AA Change: I614V

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
DEXDc 82 280 7.47e-44 SMART
HELICc 324 405 2.8e-25 SMART
low complexity region 434 445 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132008
Predicted Effect probably benign
Transcript: ENSMUST00000200078
SMART Domains Protein: ENSMUSP00000142675
Gene: ENSMUSG00000027905

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
Pfam:DEAD 87 134 7.6e-5 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to implant and develop past the 2-cell stage. Heterozygous null females are viable, healthy and fertile but show increased ovary weight, a greater number of empty follicles, a prolonged estrous phase, and reduced nocturnal and stress-induced serum ACTH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Ddx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ddx20 APN 3 105686670 missense probably damaging 1.00
IGL01832:Ddx20 APN 3 105679011 missense probably damaging 0.99
IGL02072:Ddx20 APN 3 105680627 missense probably damaging 1.00
IGL02821:Ddx20 APN 3 105679277 missense probably benign 0.00
R0520:Ddx20 UTSW 3 105687376 missense probably benign
R0600:Ddx20 UTSW 3 105679080 missense probably damaging 1.00
R1817:Ddx20 UTSW 3 105678580 nonsense probably null
R1843:Ddx20 UTSW 3 105679082 missense probably benign 0.00
R1922:Ddx20 UTSW 3 105678584 missense probably damaging 1.00
R1955:Ddx20 UTSW 3 105679562 missense possibly damaging 0.79
R1993:Ddx20 UTSW 3 105679344 nonsense probably null
R2215:Ddx20 UTSW 3 105680340 splice site probably benign
R2241:Ddx20 UTSW 3 105683205 nonsense probably null
R2315:Ddx20 UTSW 3 105678699 missense probably damaging 1.00
R4156:Ddx20 UTSW 3 105678933 missense probably benign 0.41
R4790:Ddx20 UTSW 3 105683169 missense probably benign 0.02
R4962:Ddx20 UTSW 3 105680605 missense possibly damaging 0.95
R5072:Ddx20 UTSW 3 105682875 critical splice donor site probably null
R5361:Ddx20 UTSW 3 105683509 missense probably damaging 0.96
R5622:Ddx20 UTSW 3 105679011 missense probably damaging 0.99
R5936:Ddx20 UTSW 3 105680587 missense possibly damaging 0.96
R6007:Ddx20 UTSW 3 105683420 missense possibly damaging 0.68
R6192:Ddx20 UTSW 3 105678720 missense probably benign
R6916:Ddx20 UTSW 3 105680613 missense probably damaging 1.00
R6957:Ddx20 UTSW 3 105684310 missense probably benign 0.30
R6970:Ddx20 UTSW 3 105680358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCACAGGAGTACATTCAGTGTC -3'
(R):5'- GATTCCTCCAGTAACAGCCAGCATC -3'

Sequencing Primer
(F):5'- TCTGAGGAGCCTTCCAAGTAAG -3'
(R):5'- GCATCAGGCCAAAGATAGCTC -3'
Posted On2014-04-24