Incidental Mutation 'R1648:Kif21a'
ID174055
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90994367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 237 (T237A)
Ref Sequence ENSEMBL: ENSMUSP00000104911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288]
Predicted Effect probably damaging
Transcript: ENSMUST00000067205
AA Change: T237A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: T237A

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088614
AA Change: T237A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: T237A

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100304
AA Change: T237A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: T237A

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109287
AA Change: T237A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: T237A

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109288
AA Change: T237A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: T237A

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTACTGAACTAAGGCTCTGCTG -3'
(R):5'- AAACAGGGACGCCTAACTGATTCG -3'

Sequencing Primer
(F):5'- TAGAGGATGACCCCTCCACTTG -3'
(R):5'- TATGTCCGTCAGCACAGTG -3'
Posted On2014-04-24