Incidental Mutation 'R1659:Itgax'
ID186595
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 039695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1659 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128130891 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 73 (T73I)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000098015] [ENSMUST00000205460]
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: T73I

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: T73I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098015
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134694
SMART Domains Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 39 82 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Predicted Effect probably benign
Transcript: ENSMUST00000205460
AA Change: T73I

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205866
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Golgb1 A G 16: 36,887,617 I107V probably benign Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcn1 A T 13: 117,976,074 Q858L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itga10 A G 3: 96,662,977 T1150A probably damaging Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Neu3 A G 7: 99,813,433 I361T probably damaging Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rbfox3 T C 11: 118,494,155 T359A probably damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTAAATGCTGGGCTCTTCTCCAAC -3'
(R):5'- GGACCCTTGGGTAAAGCAGACATC -3'

Sequencing Primer
(F):5'- ACAAGGAATTGTCTGTCCGTC -3'
(R):5'- CAGCATCATGGGGGTACAATG -3'
Posted On2014-05-09